header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22919
Transcript Name: ottdart00000001799
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001799 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001799|OTTDARG00000001685|ZDB-GENE-000823-7 hoxb6b|OTTDARP00000001586 hoxb6b-001 LG_ AL645798.2 Danio rerio protein_coding KNOWN, 1007 bp
ATTGGTCAGGCACTGATCAGCTGGTCCGTTTCCCCGCGGT
CTCAGATTGGAACCTCGCCACCCCCCCTTCGGCTAAAACC
AAATCTCAGATAAAGTAATGGCAAATACCACTTGGACTAT
AAAACACAACAAATCATAACACACGGACAATAACACTGGC
CACCCCATGAGTTCCTATTTCGTCAACTCAACTTTTCCCG
TGTCTCTACCCGGAGGACAGGAGTCTTTCTTGGGTCAGAT
ACCGCTATATTCCTCTGGATATACAGATTCTTTAAGACAT
TATCCAAGCGCTACGTTCGGAGCTACCAATGTCCAAGACA
AGGTTTACACCTCCTCGTATTATCAGCAAGCTGGGGGTGT
TTTTGGGAGAAGCGGATCCACCAGTGCTTGTGACTACTCA
ACACCCAATATTTACCGAACCGCTGACCGCTCGTGCGCTA
TTGGAAGTCTGGAAGACTCGCTGGTCCTAACCCAGGACCA
GTGCAAGACGGACTGCACAGAACAGGGCACAGAGAGATAT
TTTAGCACTGAAGATAAACCATGTACCCCGGTTTACCCGT
GGATGCAGAGGATGAACTCATGTAATGGAATGCCTGGCAG
CACTGGCCGCAGGGGTCGTCAAACCTACACTCGGTTTCAG
ACTCTTGAACTGGAAAAGGAGTTCCACTTTAACAGATATT
TGACAAGAAGGCGAAGAATTGAAATATCGCACGCTCTGTG
TTTGACGGAACGACAGATCAAGATATGGTTCCAAAACCGC
AGAATGAAATGGAAAAAGGAGAATAAAGCAGTGAACTCGG
CAAAGGTCAGCGATGAGGAAGATGGTGGAAAGGCTGGATA
AATGCAAAAAAGCAGCTTATGACGAAGCCCTAGAAACACT
GTACATAACATGTAGAATGTAGTTTTAATTAATACATACA
TGTTCTTTCCAACAAGAAAAAAAAACTACCTAATAAGTGT
TATGTCGACTCCAAAATGCTTCAAGAGAGATTTCTTTCTT
ATAAAAA

hoxb6b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb6b-201 (1) 1194
ottdart00000001799 1007
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001799 Contained in:
OTHER ottdart00000001799 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001799 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:Y14532 (1) 400bp
    CITATIONS (1)