ZFIN ID: ZDB-TSCRIPT-090929-8525
Transcript Name: hoxb6b-201
Previous Names: hoxb6b-001, ottdart00000025817

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025817|OTTDARG00000020592|ZDB-GENE-000823-7 hoxb6b|OTTDARP00000021223 hoxb6b-001 LG_ BX001014.6 Danio rerio protein_coding KNOWN, 1194 bp
AAACACAACAAATCATAACACACGGACAATAACACTGGCC
ACCCCATGAGTTCCTATTTCGTCAACTCAACTTTTCCCGT
GTCTCTACCCGGAGGACAGGAGTCTTTCTTGGGTCAGATA
CCGCTATATTCCTCTGGATATACAGATTCTTTAAGACATT
ATCCAAGCGCTACGTTCGGAGCTACCAATGTCCAAGACAA
GGTTTACACCTCCTCGTATTATCAGCAAGCTGGGGGTGTT
TTTGGGAGAAGCGGATCCACCAGTGCTTGTGACTACTCAA
CACCCAATATTTACCGATCCGCTGACCGCTCGTGCGCTAT
TGGAAGTCTGGAAGACTCGCTGGTCCTAACCCAGGACCAG
TGCAAGACGGACTGCACAGAACAGGGCACAGAGAGATATT
TTAGCACTGAAGATAAACCATGTACCCCGGTTTACCCGTG
GATGCAGAGGATGAACTCATGTAATGGAATGCCTGGCAGC
ACTGGCCGCAGGGGTCGTCAAACCTACACTCGGTTTCAGA
CTCTTGAACTGGAAAAGGAGTTCCACTTTAACAGATATTT
GACAAGAAGGCGAAGAATTGAAATATCGCACGCTCTGTGT
TTGACGGAACGACAGATCAAGATATGGTTCCAAAACCGCA
GAATGAAATGGAAAAAGGAGAATAAAGCAGTGAACTCGGC
AAAGGTCAGCGATGAGGAAGATGGTGGAAAGGCTGGATAA
ATGCTAAAAAACAGCTTATGACGAAGCCCTAGAAACACTG
TACATAACATGTAGAATGTAGTTTTAATTAATACATACAT
GTTCTTTCCAACAAGAAAAAAAACTACCTAATAAGTGTTA
TGTCGACTCCAAAATGCTTCAAGAGAGATTTCTTTCTTAT
AAAAACAGGCATCGAACTCACCTCTGTAATGAAGGTAAAA
GTTCTGGAAGGTGCTTTAACTACTGTTAAGTATTTTATTT
GGACTTTCAAATGTAATAAGATGAACGTTTTCAAACGCTT
AAGCGTTGTAATGCCTAATTTGAAAGAAAAGTTCATGCTT
AAAACTTTGGGTTTAATGGTCCTGTATTCAGTCCACGTGT
GTTAGAAAAAAGAAAATGTGACATTTTTATTCTTAATTTA
TTGGGTCGTCACTTTTGTGTAAATGTGAATGCACTATGAA
TAATACGCTACCATACTTTGTTAGCAATGTCATT

hoxb6b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb6b-201 1194
ottdart00000001799 (1) 1007
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb6b-201 Contained in:
OTHER hoxb6b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025817 (1)
  • Ensembl_Trans:ENSDART00000025966 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO928607 (1) 850bp
    GenBank:CK704524 (1) 832bp
    GenBank:CB354292 (1) 587bp
    GenBank:DQ060548 (1) 351bp
    CITATIONS (2)