header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22641
Transcript Name: ottdart00000001849
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001849 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001849|OTTDARG00000001731|ZDB-GENE-000823-2 hoxa9b|OTTDARP00000001634 hoxa9b-001 LG_ AL645795.3 Danio rerio protein_coding KNOWN, 726 bp
ATGTCGACATTGGGAACACTAAGTTACTACGCTGACTCAC
ACATTCCACACGAGAATGACGATCATTTGGCACCGAGGTT
CTCATCTGGACCCGTGGTCCAGCAGCAGTCTCGTGAACTG
ACGCTACTTGAATATAGCGAACAAGAGCCCTATACTTTCC
AGGCCAAATCATCCATTTTTGGTGCGTCGTGGAGTCCCGT
GCAGCCCACAGGCGCATCTATCGCCTACCACCCATACATT
CATCACCCATGTTCAACAGGAGACAGCGATGGAGCATCCG
TGCGTCCCTGGGCGTTAGAACCGCTGCCTGCACTGCCATT
CACGGGATTATCCACAGATACGCATCAAGATATAAAACTT
GAACCATTGGTTGGGAGTGGTGAGTGCACCACGCATACAC
TTCTTGTGGCTGAGACAGACAACAATACGACGCAAACGGA
GAGGAAGGTACCAGACGATGCTGTTTCCAACGGATCACAT
GATGAGAAAATTCCTGCGGAGACGAAGCTAGATCTAGACC
CAAATAACCCTTCGTCCAACTGGCTGCATGCGAAGTCCAC
TAGGAAAAAGCGGTGTCCGTACACTAAGCACCAAACACTC
GAGCTGGAAAAAGAATTTCTGTTTAATATGTACCTCTCTC
GCGACCGTAGATATGAAGTGGCAAGACTCCTAAATCTCAC
CGAGAGACAAGTCAAAATTTGGTTCCAAAACCGTAGGATG
AAGATG

hoxa9b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxa9b-201 (1) 1495
ottdart00000001849 726
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000001849 Contained in:

OTHER ottdart00000001849 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001849 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES No data available
    CITATIONS (1)