header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17715
Transcript Name: hoxa9b-201
Previous Names: hoxa9b-001, ottdart00000037291

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037291 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037291|OTTDARG00000027643|ZDB-GENE-000823-2 hoxa9b|OTTDARP00000029880 hoxa9b-001 LG_ CR392024.15 Danio rerio protein_coding KNOWN, 1495 bp
AGAGGTCTGTAGTTCACAGCGAAGTCAAGTAGTTAGTTAC
TTGATTTCAACGGATTCTGCTTTTGAGTCAGTTTCATTGT
GGGTGTATCCGTCCGGCTGCTCTCTCTTTACTTGTTTTTG
TTATGTCGACATTGGGAACACTAAGTTACTACGCTGACTC
ACACATTCCACACGAGAATGACGATCATTTGGCACCGAGG
TTCTCATCTGGACCCGTGGTCCAGCAGCAGTCTCGTGAAC
TGACGCTACTTGAATATGGCGAACAAGAGCCCTATACTTT
CCAGGCCAAATCATCCATTTTTGGTGCGTCGTGGAGTCCC
GTGCAGCCCACAGGCGCATCTATCGCCTACCACCCATACA
TTCATCACCCATGTTCAACAGGAGACAGCGATGGAGCATC
CGTGCGTCCCTGGGCGTTAGAACCGCTGCCTGCACTGCCA
TTCACGGGATTATCCACAGATACGCATCAAGATATAAAAC
TTGAACCATTGGTTGGGAGTGGTGAGTGCACGACTCATAC
ACTTCTTGTGGCTGAGACAGACAACAATACGACGCAAACG
GAGAGGAAGGTACCAGACGATGCTGTTTCCAACGGATCAC
ATGATGAGAAAATTCCTGCGGAGACGAAGCTAGATCTAGA
CCCAAATAACCCTTCGTCCAACTGGCTGCATGCGAAGTCC
ACTAGGAAAAAGCGGTGTCCGTACACTAAGCACCAAACAC
TCGAGCTGGAAAAAGAATTTCTGTTTAATATGTACCTCTC
TCGCGACCGTAGATATGAAGTGGCAAGACTCCTAAATCTC
ACCGAGAGACAAGTCAAAATTTGGTTCCAAAACCGTAGGA
TGAAGATGAAGAAATGCAATAAAGATCGCCCAAAAGACAT
TTAAAAAGAGGAAAGCTGTACCCGCGCACTGCAGTTGGAA
GAAATTGTTTGTGAATTAGCCAGTCTTTTGCCTCATGCAC
AACCACATTTTATCATTATAGATAGCCTACATTTTGTATT
GTTAGATGTACATTGCACAAACATTTGATCTGAGAGAATG
CTTGTATATATGATTATGTTTTGTATACAGCCTGTTGTTG
ATTCCTCTCATTTGGATTGCTTGTTGTAGGTCTAATTTCG
TATTGTAAATGTTTAGTTTGTTGTTAAAGTTTTTAAATGT
ACTTAATGATTTCAGGGAAATAGGTTCTGCGATATGAAAA
GTTGATGATATGCATGAATTTTAATGATTATTATTTTTAA
TTTTCAAACTTAGGCTATCTTGTAGTGTAATGTATAAATG
TTTATTGTGACTACCTAGATGTATTTGAACTACCTATGTA
TTAAGATGAATTAATTTATGCTGTGTTGTTCGTCATCGAA
ATATTTCATTGAATTTTGTAACATATATGCTTGTAATGTT
ATATGCATACGCCAATACCTCAAATCAACAGTGTTAGTCG
TTTTCAAATGAAATATCACTTCTGTAAATAACAAATAAAT
TTCTGATAAACACTA

hoxa9b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxa9b-201 1495
ottdart00000001849 (1) 726
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxa9b-201 Contained in:
[BAC] DKEY-45E15 (1) (order this)

OTHER hoxa9b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037291 (1)
  • Ensembl_Trans:ENSDART00000079383 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095300 (1) 1498 bp
    GenBank:CT669294 (1) 802 bp
    GenBank:CK698217 (1) 694 bp
    CITATIONS (2)