Transcript

pam-002

ID
ZDB-TSCRIPT-090929-22467
Name
pam-002
Previous Names
  • si:dkeyp-35f12.2-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000042787 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042787|OTTDARG00000030803|ZDB-GENE-090313-384 pam|no_translation DKEYP-35F12.2-002 LG_ BX294128.19 Danio rerio protein_coding NOVEL, 650 bp
GGCACCTCCAACGATGAGATGTGTAACTTCTACATCATGT
ACTACATGGACAACACCCATGCTGTGCCTTACATGAACTG
CAGAGATGATGGCAGCAGTGAGCTCTTCAGAAACATCCCT
TCTGAGGCCAATATTCCAATCCCGGTCAGGCCAGACCATA
TGATGTCCATGAAGCATGAATCTTCTCCTCAAAAAGATGC
TGTGGAGCTTCAGGAGCCCAAGAGAGATGAGGAAGTACAG
GATCAAGGTGCCCATCTGGTGGAGGTGTCAGACTGGCCTG
AGGCGGATCTGCAGCTCGGACAGGTCTCTGGTCTGGCTCT
CAACTCTAACGGTGACCTGGTCATTTTCCACCGAGGCGAT
CACATTTGGGGAATTGACTCCTTTAATATGAACGCCATCT
ACCAGCTGAGGGATCAAGGCCCGATTCAACAATCCACAAT
CCTTCTGGTGGATTCAGTCAAAGGAAAAGTGCTCAAAGCT
TCAGGAAAAAACATGTTTTATTTGCCACATGGAATAACTA
CTGATCATGACGATAATTACTGGGTGACCGATGTAGCACT
TCATCAGGTATTCAAACTGAGCGGCAACGGCAAAGATCAG
CAGCTTCTGGTCTTGGGAGAAGCTTTTGAACCAGGAAGTG
ACAAGAAGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations