Transcript

pam-203

ID
ZDB-TSCRIPT-090929-22466
Name
pam-203
Previous Names
  • pam-001
  • si:dkeyp-35f12.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000042786 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042786|OTTDARG00000030803|ZDB-GENE-090313-384 pam|OTTDARP00000033967 DKEYP-35F12.2-001 LG_ BX294128.19 Danio rerio protein_coding NOVEL, 4083 bp
GTGGTAACACACTCCTGAGCTCATGTATCGATTACACTGG
TCTGACTGAACACTGAACATGAACAAAACAAGCACAGAAA
ATAAAGGTCGTGACAGGAGCCTGATGCTAAATTCGTGATA
TGCTCTGCCCGGCGTGAGGAGCAAGGAGCCTTTCTCCTCC
TCCTCTCCATCCCTCTTGCTGGTGTCACACTGTATCCGGA
CAGAACTTGGTGTGGAGGCGACTGACACTTTTATGACACA
TTTTTAAAGAGATTGAGCAAGTGAGACGAGCAGAAGAGAG
AGAGAGTCAGAGGAGTTGGAGAACCAGCAGTATTGTCATT
GCTTATGGAGGAGGAGGGGCAGGATTGACGTGGAAATCGC
ATCAGCTTGCTTTCAGTTTTATCATTGATCGCTATTCCGT
CCAATCAGAGATGGGCGTCCTGTGCTGCAGCATCCTCGTG
CTTGCACTTTTTTTGCAGTGCCATAGTCACAGTATCCAAA
ACCACATGTACAGGTTCAAGAGGTTTCAGGAAAATTCCTT
TACAGACCCCAATGACTGCTCAAGGACCAGACAGCCTTTT
GTCATGTCCAGTCCGTACAATTTTTCACTGGATATTCGCC
TACCTGGGGTGGTCCCAACAGAGTCTGATAGCTACTACTG
TATGGCTGTTCCTGTCCCAACCTCACGGGAGGCCTATATT
GTGGACTTTGTTCCCCATGCCAGTATGGACACAGCCCACC
ACATGATTTTATATGGCTGCAAAACCCCTTATGCTACTCA
AGGATACTGGGATTGCGGGAAAGAGCTGGGGACCTGTCGG
GATCAGGCCAAGATCATGTACGCCTGGGCCAGGAACGCTC
CTCCAACTAAACTACCCAAAGATGTTGGCTTTAAAGTTGG
AGGAGACACAAGAATTAACTACTTTGTGCTGCAAATTCAC
TATGGTGATGTCAACAACTTTAGAGATCATCATAGAGACT
GCTCAGGACTCTCTTTAAGAATGACTTCCAAACCACAGCC
CTTTATTGCTGGCATGTATCTGATGATGTCTGTGGACACT
CTGATTCCTCCTGGGAAAAAAGTTACCAATGCAGACATTG
CTTGCACTTACACATCTTCCCCGATGTATCCATTTGCCTT
CAGGACACACACACACAGCCTTGGTAAAGTTGTAAGCGGG
TACAGGGTTCGAAATGGACAGTGGACTCAGATTGGACGAC
AATCTCCACTGTTGCCGCAGGCTTTTTATCCAGCCACCAA
CACAATTGATGTAAAAGATGGAGACATACTAGCAGCCCGT
TGCGTGTTCACAGGGGAAGGACGAACCACTACAACTCAAA
TTGGAGGCACCTCCAACGATGAGATGTGTAACTTCTACAT
CATGTACTACATGGACAACACCCATGCTGTGCCTTACATG
AACTGCAGAGATGATGGCAGCAGTGAGCTCTTCAGAAACA
TCCCTTCTGAGGCCAATATTCCAATCCCGGTCAGGCCAGA
CCATATGATGTCCATGAAGCATGAATCTTCTCCTCAAAAA
GATGCTGTGGAGCTTCAGGAGCCCAAGAGAGATGAGGAAG
TACAGGATCAAGGTGACCTCTATTCCCTTCTTTCTAAACT
GCTGGGGGAGAGAGAGGACCATGTCCGCATACATAAGTAC
AAACCTTCAGAGGCGGCTCGAGCCCAGACTCTTCTGCTGG
CAGAGATTGATAGCATAATGCAGAAAAAAGACCTGGGCCG
GCCACGTTTAGGCTACAAAACAAACGAAGATGCAATTCTG
GCGAGAGACAGAGTGCACAAGTTTCACCAATTAGAGTCCA
CTGTCAGCCCCTGGAGGAGCAGGACTGTTCCCGCCAGACT
GCCGACCACAGGGGCGGCTCAAAGGGACCAACAAGGTGCC
CATCTGGTGGAGGTGTCAGACTGGCCTGAGGCGGATCTGC
AGCTCGGACAGGTCTCTGGTCTGGCTCTCAACTCTAACGG
TGACCTGGTCATTTTCCACCGAGGCGATCACATTTGGGGA
ATTGACTCCTTTAATATGAACGCCATCTACCAGCTGAGGG
ATCAAGGCCCGATTCAACAATCCACAATCCTTCTGGTGGA
TTCAGTCAAAGGAAAAGTGCTCAAAGCTTCAGGAAAAAAC
ATGTTTTATTTGCCACATGGAATAACTACTGATCATGACG
ATAATTACTGGGTGACCGATGTAGCACTTCATCAGGTATT
CAAACTGAGCGGCAACGGCAAAGATCAGCAGCTTCTGGTC
TTGGGAGAAGCTTTTGAACCAGGAAGTGACAAGAAGCATT
TCTGCCAGCCTACAGATGTGGCCGTAGACCCTGTTACTGG
AAACGTCTATGTTTCAGATGGCTATTGCAATTCCAGGATC
CTTCAGTTCTCACCTGAGGGCAAATACATTTCACACTGGG
GAGCAGATCAAAGGAAAAGTGCGCTCTCCTCCGCTCTTCC
TGGCCGACGTGTCCCGTTCCGGATCCCGCACAGCCTGACA
TTCCTGCCGGATAAACGGGAGTTGTGTGTGGCGGATCGAG
ACAATGGGCGGATCCAGTGCTTCATGGCAGATACTGGCGA
GTTTGTGAAGGAGATCAAGAAAGACGTGTTTGGAGGAGAA
GTGTTCGCCATTGCATACTCACCTGCTCAAGGTGGCCTAC
TCTACGCTGTGAACGGAGAACCTCCATACGGTCAGGCTGC
ACCTCTTCAGGGGTTTGTCATCAATTACTCAAGCAAGGAA
ATCCTGGATTCCTTCAGTCCAGACACACAGGTATTTAAGT
TACCACATGACATTGTTGTGACAGCAGATGGGACTGTGTT
TGTTGGAGACGCAGCAGCAGATTCTGTAATGAAGTTCATT
CAGTCTGCAAAGGCAGAACATCGCTCGGTTAAAAAGGGTG
GAATCGAGGTCCAAGAAATCGAAGAAACAGAAACGTTTGT
GCAGGCCAAGCTGAAGCCGTTACCCAAGATTCCCCCTCAT
TATGTGGAGGCGGCTGTGCAGAAGATCCAAGAAGTGTCTC
CGCATCAGCAGCCGCTGGCAGCTCCGAAAGAGAAAGAGCC
TCCGCAGAGCGTGGCCAATCACAGCCCTGAGAGTGTGGCC
AATAAGAGCCCTGAGAGCGTGGCCAATCAGAGCGCTCAGA
ATGTGTCTCCCGCCGTCATCACAAGCCTCCTGCTGGTCCC
GCTGGTGAGCGTCATCGCCATCGGGGTCTTCATCCGCTGG
AAGAAGAGCAGGATGTACAGCGATGATTGTCAGGTGAAGC
TGGAGCCTTCAGGGTCAGCAGGAGGAATCTTGGGCAAAAT
CAGAGGCAAAGCAGCAGGAAGCCTGAACCTGGGCAATTTC
TTCGCCACTCACAAAGGCTACACTCGACATGGCTTCGACC
GGCTGAGCACTGAGGGCAGCGACATGGAGAAAGACGACGA
GGACGCCACCGACTCAGAGAACGAAGAGTACTCCGCTCCA
CCACCGCCAATCTCATCCTCCTAAACAAAAGAGCCCGTCC
CTCCGCTTCGGTCACCTCTGTAATCGTTCGTATCGGCTGC
TGAAACATTCGATCTCTAGTGTAAAACTGTCCTCCCCGAG
ACCCACGACTGCCACTTTAATTTATGCGTTTTTTTTAAAG
GGACCACGCCGAGATGGTCATTTTAAGGAGAAAGATGATT
ATTTTTTAACAAGAGAGTAAAGGTAGATTTATTTATTGAG
TTTTTACCTGCGACTTCGTTTCTTCCGATAACTTATCGAT
CCGATAGCAGTGCAATTAATATATATAAAGGATCCAGGCA
TTTCATGTCATAACATTTTCTGTATGTTTGTGCCTTTTCT
GTATTTCGCCTTCTGCAGCACCTATATATATATATATTAT
TACAGACGTGCCACATATTTAAGAGCTGCTACTGTCTACT
GTGATTTGAGTTGTTTTTTTTGCATCTGATAAAACGGAAA
AAAAAACGACAGAAAAAAAGATGACGTATTTAAGGCTGCA
TTTACTACATTTTCAAAGCTAATGTGAGACGTGTCTGATA
TTTGTTGTGATACTGAGGTTTTATTGCAAGAATACTATTT
TCAGTAACAATGTTATTTGTGTAATAAAGTGTCTGCAAAG
CAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations