ZFIN ID: ZDB-TSCRIPT-090929-22287
Transcript Name: si:dkey-178k16.1-203
Previous Names: ottdart00000042587, si:dkey-178k16.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042587 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042587|OTTDARG00000030691|ZDB-GENE-090312-61 si:dkey-178k16.1|OTTDARP00000033843 DKEY-178K16.1-001 LG_none CR394557.6,CR735125.12 Danio rerio protein_coding NOVEL, 2544 bp
CTGAGGTCAAGATCGAGACGCAGCCCAATGGCTCAGAGGT
CACCACAACCATAATGGAGATTGCAGACCCGGACCATGGT
ATCAGCGGTATGCGAGAAGCTGCGTACTCTATGACAGAGA
GAGTCTCTCCTGTGAACTTGGGATCATTAGCTAGAGATGG
TTCTCCACTAATGGTTACTGAGAATGTAACATCTGCCACT
ACAACTCATGTTACTAAGACGGTGAAAGGAGGCTACTCAG
AGACAAGAATTGAAAAGAGGATCATCATTACTGGTGATGA
TGATGTTGATCAAGATCAGGCGCTCGCCATGGCAATAAAA
GAAGCCAAGCAACAGCACCCTGACATGTTGGTAACCAAGG
CTGTAGTTGTCAGGGAAACAGAATCTTCCACGCAAGATCC
ACATGAGGAATCGAAGTCCTGATCTCCTCACTTCTCAGGA
CTTCATCGAGAATCAACTTTTCCTCAATGACTGCCAGTGG
GTCTCCAAACATCTACAGACCTCTAATATTAAGCTTCTTG
CTTCCACTTACATACACAACACTAACATTTACACATGCAC
ACAAACACATGCTGCCTCCCAGACGTCGGAACCTATTCCT
GCTCATGTAATTTCTATTTCGTGTCTACATTTGCTGTGGT
AATATGGACCAGGAGGCACACGGTCTTCCTCCCAGAGGAC
CGCTTTGGAGGGACGGACTCAGCATCACATCGATCAGACG
ACTTAGCCGCCATTGTAGTCTCTTGCTTTTTCTTCACACA
TGTGAAAACTAACCAAGCGTACTATCAACAGCCCGATGCT
AACATCAAGCATGAGGCATAGGGCTTTTTGATGAACGTGC
TGAATTAGCTTAGTGGAGTGACAGTAGTGTCTATTGAGTA
GTTTTTTTCTAGGGTTCATTGAGATATAAAAACAGAAGAT
CTTTTTTGCAAACACTGAACTGTAGGGAAAGCCTAGCTAG
TGTGCATACAGTATGTCGTGCTTCTCAAATCAACAGATTA
TGTTGCTGTTCAATTCTGAACCATCATCTGCATGTGACAA
AGCAGGGTTTAAAATAATTTTCGTATTTCATACAACTAAC
TATAACCTATAACCTGGTTTAGGACCCTAGCAAAACGAGA
CTGTATTAATGTATGGTTGCCAAAACATTTGACTGTCCTC
TTATAAGTACTTCATTTCCGCATTAAACATAATATGGAAG
TAGTCGACTTGCACATTTACCTCCCGAAAACCTGTTCTTT
TATTACTTTTACAGATATCCAGAATGTGTTTTCAGTTATT
CCGGGAACACTTGCATCAGCCTAGTAGATATCACAAACAA
AGAAAATACACCTATTTTCAGTACAACCTTTTTCAAAGTA
CCTTTAGTATTCAAGTTTAGATTTTAGAATTAAAATATCC
CCAAGTATGAAATGCACGATACAAAAAGTAACATGTTTGC
TTGTTGAATGCTCTATTTCATCTTCTGCGCATATCGTTAA
ACTGTGAAAAATTATTTGAAGTCCAAAGAAACCAAACCTA
ATTTGAATTTAGTACATGCTGACATGATACATAAATAATC
AATGTTATGTGCATGTGCGTTTAGAGTTTAAGCATTTGAA
GAAGAAGAAAAAAATAATCATTTTTAAAAGGATTGCAAAA
AATAATAATTTTGAATTATTTTCCAACAAGCTGGTACTTA
TAGCAAATTCCCTACTGCTCTGTATGTTTTTAAAACTTCT
GTGATTTGTTTTTTTTTAAACTGTTCCTTCCCGCACAATG
CTGTGCCAACGAACTAATGATTTAAAAAAAATGGATTTGT
TAGATATGAGAACTTTTTATGTGTAAATGTCATGAGCCTG
TGGTTTTCAGTGAAGCGTGACCCTTGAGCCATGAATCTCT
TTACAAACCTTCCTCTGTGAAAGCGGTAGAAATCCTGGAT
GAGACAGGACGTGTATGTGTTCTAGTATTGAATGGATGAA
TGAACTTTGAATTGTGAGTATTGCCAAATGAAAAACCTAG
CAGACTCTATGTAAGGACGAAAGAAAGCCAGGACAGCTCT
CGATAACCTTTGCTAACATGGTCAAGGCTTGTTGTTGTGT
AACTAATGCATTTGTTCAGGCCTGTGCACTATGTGAAAAT
TAAAACAGCCTGCAGATATCAGAAGGGGGATTTGTAAATG
TCTTACTTCCAACTTGTACAGTTGCTGATTTTTGAGAACA
AGGGAGCTGACCTAGGATATAAAGAAAAGAAGTGCCATGC
AAAGGTTGATAGTTGGATGTCAAGTCAACCACAGCATTCT
TTCGCCAGCTCATTTGCTAAGCCTATGTCAGAGTTTTGTC
ACTTTACAAGACAAATGCCCTCGTTTATGCTGTACATGTT
GCATTTAACATTTGAACTTTGAGGAAAACAAGTTAAGCTT
AAAAAAAAATCAATATTTTAGCATTGACTCCCCTGAGATT
CCACCTGCAGAAACTTCTGTTTACACTGCTATCCTCTCTA
CTTTCTACTGCTTGGTTTTGTGTGTTTGCTGTACAGTGTT
CGAAATAAATACGATTCATCCAAG

si:dkey-178k16.1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-178k16.1-202 (1)    Ensembl 1736
si:dkey-178k16.1-203 2544
ncRNA si:dkey-178k16.1-003 (1)    Ensembl 573
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-178k16.1-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000042587 (1),  Ensembl_Trans:ENSDART00000143481 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI473219 (1) 428 nt
GenBank:EB942810 (1) 410 nt
GenBank:EB946186 (1) 318 nt
GenBank:CK691439 (1) 216 nt
CITATIONS (2)