Transcript

si:dkey-178k16.1-203

ID
ZDB-TSCRIPT-090929-22287
Name
si:dkey-178k16.1-203
Previous Names
  • ottdart00000042587
  • si:dkey-178k16.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042587 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042587|OTTDARG00000030691|ZDB-GENE-090312-61 si:dkey-178k16.1|OTTDARP00000033843 DKEY-178K16.1-001 LG_none CR394557.6,CR735125.12 Danio rerio protein_coding NOVEL, 2544 bp
CTGAGGTCAAGATCGAGACGCAGCCCAATGGCTCAGAGGT
CACCACAACCATAATGGAGATTGCAGACCCGGACCATGGT
ATCAGCGGTATGCGAGAAGCTGCGTACTCTATGACAGAGA
GAGTCTCTCCTGTGAACTTGGGATCATTAGCTAGAGATGG
TTCTCCACTAATGGTTACTGAGAATGTAACATCTGCCACT
ACAACTCATGTTACTAAGACGGTGAAAGGAGGCTACTCAG
AGACAAGAATTGAAAAGAGGATCATCATTACTGGTGATGA
TGATGTTGATCAAGATCAGGCGCTCGCCATGGCAATAAAA
GAAGCCAAGCAACAGCACCCTGACATGTTGGTAACCAAGG
CTGTAGTTGTCAGGGAAACAGAATCTTCCACGCAAGATCC
ACATGAGGAATCGAAGTCCTGATCTCCTCACTTCTCAGGA
CTTCATCGAGAATCAACTTTTCCTCAATGACTGCCAGTGG
GTCTCCAAACATCTACAGACCTCTAATATTAAGCTTCTTG
CTTCCACTTACATACACAACACTAACATTTACACATGCAC
ACAAACACATGCTGCCTCCCAGACGTCGGAACCTATTCCT
GCTCATGTAATTTCTATTTCGTGTCTACATTTGCTGTGGT
AATATGGACCAGGAGGCACACGGTCTTCCTCCCAGAGGAC
CGCTTTGGAGGGACGGACTCAGCATCACATCGATCAGACG
ACTTAGCCGCCATTGTAGTCTCTTGCTTTTTCTTCACACA
TGTGAAAACTAACCAAGCGTACTATCAACAGCCCGATGCT
AACATCAAGCATGAGGCATAGGGCTTTTTGATGAACGTGC
TGAATTAGCTTAGTGGAGTGACAGTAGTGTCTATTGAGTA
GTTTTTTTCTAGGGTTCATTGAGATATAAAAACAGAAGAT
CTTTTTTGCAAACACTGAACTGTAGGGAAAGCCTAGCTAG
TGTGCATACAGTATGTCGTGCTTCTCAAATCAACAGATTA
TGTTGCTGTTCAATTCTGAACCATCATCTGCATGTGACAA
AGCAGGGTTTAAAATAATTTTCGTATTTCATACAACTAAC
TATAACCTATAACCTGGTTTAGGACCCTAGCAAAACGAGA
CTGTATTAATGTATGGTTGCCAAAACATTTGACTGTCCTC
TTATAAGTACTTCATTTCCGCATTAAACATAATATGGAAG
TAGTCGACTTGCACATTTACCTCCCGAAAACCTGTTCTTT
TATTACTTTTACAGATATCCAGAATGTGTTTTCAGTTATT
CCGGGAACACTTGCATCAGCCTAGTAGATATCACAAACAA
AGAAAATACACCTATTTTCAGTACAACCTTTTTCAAAGTA
CCTTTAGTATTCAAGTTTAGATTTTAGAATTAAAATATCC
CCAAGTATGAAATGCACGATACAAAAAGTAACATGTTTGC
TTGTTGAATGCTCTATTTCATCTTCTGCGCATATCGTTAA
ACTGTGAAAAATTATTTGAAGTCCAAAGAAACCAAACCTA
ATTTGAATTTAGTACATGCTGACATGATACATAAATAATC
AATGTTATGTGCATGTGCGTTTAGAGTTTAAGCATTTGAA
GAAGAAGAAAAAAATAATCATTTTTAAAAGGATTGCAAAA
AATAATAATTTTGAATTATTTTCCAACAAGCTGGTACTTA
TAGCAAATTCCCTACTGCTCTGTATGTTTTTAAAACTTCT
GTGATTTGTTTTTTTTTAAACTGTTCCTTCCCGCACAATG
CTGTGCCAACGAACTAATGATTTAAAAAAAATGGATTTGT
TAGATATGAGAACTTTTTATGTGTAAATGTCATGAGCCTG
TGGTTTTCAGTGAAGCGTGACCCTTGAGCCATGAATCTCT
TTACAAACCTTCCTCTGTGAAAGCGGTAGAAATCCTGGAT
GAGACAGGACGTGTATGTGTTCTAGTATTGAATGGATGAA
TGAACTTTGAATTGTGAGTATTGCCAAATGAAAAACCTAG
CAGACTCTATGTAAGGACGAAAGAAAGCCAGGACAGCTCT
CGATAACCTTTGCTAACATGGTCAAGGCTTGTTGTTGTGT
AACTAATGCATTTGTTCAGGCCTGTGCACTATGTGAAAAT
TAAAACAGCCTGCAGATATCAGAAGGGGGATTTGTAAATG
TCTTACTTCCAACTTGTACAGTTGCTGATTTTTGAGAACA
AGGGAGCTGACCTAGGATATAAAGAAAAGAAGTGCCATGC
AAAGGTTGATAGTTGGATGTCAAGTCAACCACAGCATTCT
TTCGCCAGCTCATTTGCTAAGCCTATGTCAGAGTTTTGTC
ACTTTACAAGACAAATGCCCTCGTTTATGCTGTACATGTT
GCATTTAACATTTGAACTTTGAGGAAAACAAGTTAAGCTT
AAAAAAAAATCAATATTTTAGCATTGACTCCCCTGAGATT
CCACCTGCAGAAACTTCTGTTTACACTGCTATCCTCTCTA
CTTTCTACTGCTTGGTTTTGTGTGTTTGCTGTACAGTGTT
CGAAATAAATACGATTCATCCAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations