Transcript

si:dkey-178k16.1-202

ID
ZDB-TSCRIPT-090929-22285
Name
si:dkey-178k16.1-202
Previous Names
  • ottdart00000042585
  • si:dkey-178k16.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042585 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042585|OTTDARG00000030691|ZDB-GENE-090312-61 si:dkey-178k16.1|OTTDARP00000033842 DKEY-178K16.1-002 LG_none CR394557.6,CR735125.12 Danio rerio protein_coding NOVEL, 1736 bp
CCATCCACCCGAGAGCTGCTCTTCCCCCTCCGCCCGCTCA
TTCATCCTCTCGGACAGTCAGTCTCCATCCTCTGACGGAG
AACAGAAGCAGCAGGGCGGTGGCAGCCGAAGCCCTCAATG
GTCGGCATTTGGACGGAAATCCGCGCGTCAAACCTGGAGA
GACAGGACTGCAAGTGATTGCTATGTCAGAGAGAAATTCA
GCCACCAAGAACCCAGCAGACGGAGGTTTTACGGATCACG
ATTCAAAGATGTCAGATGAGCACCGAGACACGGATGATTC
GTCTGAGAAAACACCCAGTAGGATGTCCAGATCACCACAG
AAATCCAAAAGACCAAAGACGGTGCCTGTGAAAGTCCTGC
TGCTGGACGGCTCGGCCTACGAGAGCGGCGTTGAGAAGCT
CTGTAAAGGACAAGTGTTACTGGATATGGTGTGTGAACAT
CTCAACCTGTTGGAGAAGGACTACTTTGGTCTGAGCTTTA
GTGACACGGAGTGTCAGAAGAATTGGCTCGATCCTTCAAA
AGAAATCAAGAAACAAATCCGTGTGGGTCCTTGGCATTTC
TCCTTTGCTGTCAAGTTCTATCCCCCTGATCCGTCTCAGC
TGATTGAAGACATCACACGGTATTACCTGTGTCTGCAGCT
GAGGGAGGACATTCTGTCAGGTCGTTTGCCCTGCTCGTTC
GTCACTCATGCTCTACTGGGCTCATACGCCATTCAGGCTG
AGCTGGGAGACTATGACCCCGAGGAACACGGGCCAGACTA
CATCAACGAGTTCCGCTTTGCCCCCAATCAGACTCGCGAG
CTGGAGGAAAGGGTGATGGAGCTGCACCGCACCTACAGGG
GTATGAGTCCTGCAGAGGCTGAAATCAACTTCCTGGAGAA
TGCCAAGAAACTCTCCATGTATGGCGTTGATCTCCATCAT
GCTAAGGACTCTGAAGGTATCGACATCATGCTGGGGGTTT
GTGCCAGTGGCCTTTTGATCTACAGAGACAGGCTGCGCAT
CAACCGATTCGCCTGGCCCAAGATCCTCAAAATATCATAC
AAGAGAAGCAACTTTTACATCAAAATCCGACCTGGAGAGT
ACGAGCAGTTTGAGAGCACCATTGGCTTCAAGCTGCCCAA
CCACCGTGCCTCTAAGCGCTTGTGGAAGGTCTGCATTGAA
CACCACACATTTTTCAGGTTGGTCTCTCCTGAGCCTCCCC
CAAAAGGTTTTCTTGTGATTGGCTCAAAGTTCCGCTATAG
TGGACGAACCCAAGCCCAGAGCCGACAGGCTAGTGCTTTG
ATTGACAGGCCAGCTCCTCAATTTGAACGATCCATTAGTA
GAAGGTACCTGTTGTCCCGCAGCATAGACGGAGAGTCTGC
TTTAGGGGACACCATGGACCGACTCTCTCAGCACACTTCC
AGTGAGCCTGTGCCTAGTCTTCCTAGAGATGAGCTGGACC
AGGACTACCTAGAGCCCAGTCTAGATCAGGACCTGGACCA
AGATCATGAACAAGAAGAAGAACAGCGACTAGAGAGTGAC
TCCACTCCCTCTAAAACGGTGGAGCTCAAGAGGGAGGAGG
CAGGTTCTCCTGTAGACTCTAAGACAGAGCAGTTCCTGGA
TAAACCAGAGGATGTGTTGCAGAAACATCAAGCCAGCATC
AATGAGCTGAAAAGAGCGCTGAGGGAGCCCAACAGCAAAC
TGGTCCACAGAGAAAAACGTCTCTCTGGAGCCTCATCTGG
TAGCACTCCGGAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations