header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22285
Transcript Name: si:dkey-178k16.1-202
Previous Names: ottdart00000042585, si:dkey-178k16.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042585 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042585|OTTDARG00000030691|ZDB-GENE-090312-61 si:dkey-178k16.1|OTTDARP00000033842 DKEY-178K16.1-002 LG_none CR394557.6,CR735125.12 Danio rerio protein_coding NOVEL, 1736 bp
CCATCCACCCGAGAGCTGCTCTTCCCCCTCCGCCCGCTCA
TTCATCCTCTCGGACAGTCAGTCTCCATCCTCTGACGGAG
AACAGAAGCAGCAGGGCGGTGGCAGCCGAAGCCCTCAATG
GTCGGCATTTGGACGGAAATCCGCGCGTCAAACCTGGAGA
GACAGGACTGCAAGTGATTGCTATGTCAGAGAGAAATTCA
GCCACCAAGAACCCAGCAGACGGAGGTTTTACGGATCACG
ATTCAAAGATGTCAGATGAGCACCGAGACACGGATGATTC
GTCTGAGAAAACACCCAGTAGGATGTCCAGATCACCACAG
AAATCCAAAAGACCAAAGACGGTGCCTGTGAAAGTCCTGC
TGCTGGACGGCTCGGCCTACGAGAGCGGCGTTGAGAAGCT
CTGTAAAGGACAAGTGTTACTGGATATGGTGTGTGAACAT
CTCAACCTGTTGGAGAAGGACTACTTTGGTCTGAGCTTTA
GTGACACGGAGTGTCAGAAGAATTGGCTCGATCCTTCAAA
AGAAATCAAGAAACAAATCCGTGTGGGTCCTTGGCATTTC
TCCTTTGCTGTCAAGTTCTATCCCCCTGATCCGTCTCAGC
TGATTGAAGACATCACACGGTATTACCTGTGTCTGCAGCT
GAGGGAGGACATTCTGTCAGGTCGTTTGCCCTGCTCGTTC
GTCACTCATGCTCTACTGGGCTCATACGCCATTCAGGCTG
AGCTGGGAGACTATGACCCCGAGGAACACGGGCCAGACTA
CATCAACGAGTTCCGCTTTGCCCCCAATCAGACTCGCGAG
CTGGAGGAAAGGGTGATGGAGCTGCACCGCACCTACAGGG
GTATGAGTCCTGCAGAGGCTGAAATCAACTTCCTGGAGAA
TGCCAAGAAACTCTCCATGTATGGCGTTGATCTCCATCAT
GCTAAGGACTCTGAAGGTATCGACATCATGCTGGGGGTTT
GTGCCAGTGGCCTTTTGATCTACAGAGACAGGCTGCGCAT
CAACCGATTCGCCTGGCCCAAGATCCTCAAAATATCATAC
AAGAGAAGCAACTTTTACATCAAAATCCGACCTGGAGAGT
ACGAGCAGTTTGAGAGCACCATTGGCTTCAAGCTGCCCAA
CCACCGTGCCTCTAAGCGCTTGTGGAAGGTCTGCATTGAA
CACCACACATTTTTCAGGTTGGTCTCTCCTGAGCCTCCCC
CAAAAGGTTTTCTTGTGATTGGCTCAAAGTTCCGCTATAG
TGGACGAACCCAAGCCCAGAGCCGACAGGCTAGTGCTTTG
ATTGACAGGCCAGCTCCTCAATTTGAACGATCCATTAGTA
GAAGGTACCTGTTGTCCCGCAGCATAGACGGAGAGTCTGC
TTTAGGGGACACCATGGACCGACTCTCTCAGCACACTTCC
AGTGAGCCTGTGCCTAGTCTTCCTAGAGATGAGCTGGACC
AGGACTACCTAGAGCCCAGTCTAGATCAGGACCTGGACCA
AGATCATGAACAAGAAGAAGAACAGCGACTAGAGAGTGAC
TCCACTCCCTCTAAAACGGTGGAGCTCAAGAGGGAGGAGG
CAGGTTCTCCTGTAGACTCTAAGACAGAGCAGTTCCTGGA
TAAACCAGAGGATGTGTTGCAGAAACATCAAGCCAGCATC
AATGAGCTGAAAAGAGCGCTGAGGGAGCCCAACAGCAAAC
TGGTCCACAGAGAAAAACGTCTCTCTGGAGCCTCATCTGG
TAGCACTCCGGAGAAA

si:dkey-178k16.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-178k16.1-003 (1) 573
mRNA si:dkey-178k16.1-202 1736
si:dkey-178k16.1-203 (1) 2544
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-178k16.1-202 Contained in:
OTHER si:dkey-178k16.1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042585 (1)
  • Ensembl_Trans:ENSDART00000134652 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB948890 (1) 599bp
    GenBank:AL909644 (1) 458bp
    GenBank:AL909645 (1) 427bp
    GenBank:EB777969 (1) 421bp
    GenBank:EB779056 (1) 371bp
    CITATIONS (2)