header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22286
Transcript Name: si:dkey-178k16.1-003
Previous Name: si:dkey-178k16.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042586 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042586|OTTDARG00000030691|ZDB-GENE-090312-61 si:dkey-178k16.1|no_translation DKEY-178K16.1-003 LG_none CR394557.6,CR735125.12 Danio rerio protein_coding NOVEL, 573 bp
AGTCTCCATCCTCTGACGGAGAACAGAAGCAGCAGGGCGG
TGGCAGCCGAAGCCCTCAATGGTCGGCATTTGGACGGAAA
TCCGCGCGTCAAACCTGGAGAGACAGGACTGCAAGTGATT
GCTATGTCAGAGAGAAATTCAGCCACCAAGAACCCAGCAG
ACGGAGGTTTTACGGATCACGATTCAAAGATGTCAGATGA
GCACCGAGACACGGATGATTCGTCTGAGAAAACACCCAGT
AGGATGTCCAGATCACCACAGAAATCCAAAAGACCAAAGA
CGGTGCCTGTGAAAGTCCTGCTGCTGGACGGCTCGGCCTA
CGAGAGCGGCGTTGAGAAGCTCTGTAAAGGACAAGTGTTA
CTGGATATGGTGTGTGAACATCTCAACCTGTTGGAGAAGG
ACTACTTTGGTCTGAGCTTTAGTGACACGGAGTGTCAGAA
GGTAAGAGTTCATCTCTTATATCACTTAATTGCACTATTT
TACTTGCATAATTATAAAATTGCTTTAAGTGAATAGTCCA
CCCAACTATGAAAAAACACTGGTAATTTAATCAACTTCAG
GCCATCTAAGTTA

si:dkey-178k16.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-178k16.1-003 573
mRNA si:dkey-178k16.1-202 (1) 1736
si:dkey-178k16.1-203 (1) 2544
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-178k16.1-003 Contained in:
OTHER si:dkey-178k16.1-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000042586 (1)
  • Ensembl_Trans:ENSDART00000147956 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH538369 (1) 611bp
    GenBank:EH559589 (1) 595bp
    CITATIONS (2)