Transcript

si:dkey-178k16.1-003

ID
ZDB-TSCRIPT-090929-22286
Name
si:dkey-178k16.1-003
Previous Names
  • si:dkey-178k16.1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042586 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042586|OTTDARG00000030691|ZDB-GENE-090312-61 si:dkey-178k16.1|no_translation DKEY-178K16.1-003 LG_none CR394557.6,CR735125.12 Danio rerio protein_coding NOVEL, 573 bp
AGTCTCCATCCTCTGACGGAGAACAGAAGCAGCAGGGCGG
TGGCAGCCGAAGCCCTCAATGGTCGGCATTTGGACGGAAA
TCCGCGCGTCAAACCTGGAGAGACAGGACTGCAAGTGATT
GCTATGTCAGAGAGAAATTCAGCCACCAAGAACCCAGCAG
ACGGAGGTTTTACGGATCACGATTCAAAGATGTCAGATGA
GCACCGAGACACGGATGATTCGTCTGAGAAAACACCCAGT
AGGATGTCCAGATCACCACAGAAATCCAAAAGACCAAAGA
CGGTGCCTGTGAAAGTCCTGCTGCTGGACGGCTCGGCCTA
CGAGAGCGGCGTTGAGAAGCTCTGTAAAGGACAAGTGTTA
CTGGATATGGTGTGTGAACATCTCAACCTGTTGGAGAAGG
ACTACTTTGGTCTGAGCTTTAGTGACACGGAGTGTCAGAA
GGTAAGAGTTCATCTCTTATATCACTTAATTGCACTATTT
TACTTGCATAATTATAAAATTGCTTTAAGTGAATAGTCCA
CCCAACTATGAAAAAACACTGGTAATTTAATCAACTTCAG
GCCATCTAAGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations