Transcript

dab1a-004

ID
ZDB-TSCRIPT-090929-22220
Name
dab1a-004
Previous Names
  • dab1-004
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000042514 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042514|OTTDARG00000018486|ZDB-GENE-060528-1 dab1a|no_translation dab1-004 LG_none BX248232.11,BX085194.14,CT583664.7 Danio rerio protein_coding KNOWN, 2168 bp
ACCCAGCTGCACGGTAAAGGAATAAGGATTTAATATGTCA
ACAGAGGCCGAACTCCAGCCTGCTGCCAGACCCAGCGTCA
GAAAGGACTCCAAGAAGAGAGGGCAGGACCGCAGTGAAGC
AGCTCTGATAAAGCGTTTTAAGGGAGATGGCGTTCGTTAC
AAGGCTAAGCTCATCGGGATAGATGAGGTCACTGCAGCTA
GAGGAGACAAACTCTGTCAGGACTCAATGATGAAACTCAA
GGGAATCGCAGCCTCTGCGCGGTCTAAAGGAGAACACAAA
CAGAAAGTTTTTCTGACTGTGTCCTTTGGGGGGATCAAGA
TCTTCGATGAGAAGTCGGGGGTACTTCAGCACCATCATGC
AGTTCATGAGATTTCCTACATCGCGAAGGATATCACGGAC
CACAGAGCCTTTGGATATGTATGCGGGAAAGAGGGAAACC
ATCGGTTTGTGGCCATCAAAACGGCTCAGTCTGCTGAGCC
GGTGATCCTCGACCTCCGCGACCTTTTCCAGTTGATTTAT
GAGATTAAGCAGAGGGAGGAGATCGAGAAGAAAGCTCAGA
AAGACAAACAGTGCGAACAAGCTGTTTATCAGACGATTCT
GGAGGAAGATGTGGAGGATCCCGTGTATCAGTACATTGTA
TTTGAGGCGGGACACGAGCCCATCCGTGACCCATCAGAGG
AGAGCATATATCAGGTCCCTACCAGCCAACAAAAGGAGGG
AGTTTATGACGTCCCAAAGCGACATCCAAATATCAACCAG
TTAGAGCTTTTTGGAGACATGTCCACCCCTCCAGATATCA
CATCGCCCTCGACTCCAGCATCTCCGGCTAACACTCTGGA
CCCCTTGCTGGCCCACCAGACCCCATCCGAACTGTTCACC
CCCTTCAACCCCGCCTCTGTACCCTCAGGTTATGTGACGA
TGGGAGCCGTGCCACCTGCGTGGGCGCAGCAACAGTTTGC
TGCTCAGGCTCCATTAGCGTTTGGCGTCCAATCCCCAGTG
CAAGTTGCGCAGGTCTTACCGGGCACTCAGCCTCTAATCT
GGGGTCAAGCCAACCTTTTCCCTGCCACTCAGCAGCAGTG
GGCTGCGATGGCTGGGGCTCACTTTTCTCCTGCCGCTTTC
ATGCCTGCCCAGACAGTAGGACCACTTCCTGCTGCCATGT
TTCAGACACTGGCTCCTATGGCAGTGCCGGCATCCTGCGA
GACGCCCACAGCGGCCATGGGTGGAGCCGTGGCAGGAACC
TCGGCCTCCACGGCCTCCAGTCCGCAACATGGAGAGCGCA
CACTGCAGAGACAGGCAAAGATGAGCAAGGAGATGTTTAA
GGAATTCCAGATGGCAAAGCCACCGGCCATGCCTGCCAGG
AAGGGCGAGCAGCCTAGCCTATCCTGCACCACAGACGCTT
TCTCCAGCTACTTCAGCAGAGTGGGAATGGCGCAAGACAC
GGATGACTGTGACGACTTCGATATCTCGCAGATGAACCTC
ACACCCGTCACCTCCACCACACCCTCCACCAACTCACCAC
CCACCCCGGCCCCTCGGCAGAGTTCTCCATCAAAGTCCTC
ATCCCACGCCAGTGACCCTCCCACCGATGACTCTTTTGGT
GAGGCAGAGGGCAGCCCTAGTCGGAGTGGAGAGGAGGATG
CTGCTGGAGACTGTCCGCAGTCTCCGGGTGCGAGTGAGCC
TCAAGCAGAGCCTGAGAGCTCAGAGACGGACAGTCCTCAG
GTCGGTAGCTAGATAGCGGCAGGTCGGGGGGAAGGACCCT
CTTTATGCCCAGATCAACAAGGGGAAGAAGTGAAGCATCA
TGGGAACTCTGCACAGACATGATCAGCGCTGGGGGGAGCA
GGAGACCAAAAACACTGGAGATCTGTGTGTGTGTGTGAAT
GTGTGCCCGTGTGTGTGCGAGTGTCACTCCAGCCTCAACG
GTCCACTTCTCTAGAGCCGCCCGTCCCCCATCACCACGTC
CTCCGCCACTCTCTCCACGACACTTTGTTTCTTTCGCACT
GTGTTCAATGCACATGACAGCGGGGCATTGTGGGGGATTT
TCGACCCTTCAGCACCCCTCATAGCCTTATGAGCCCAGCT
CTGCCGCTTCATCCATTCTCACGTTTCCTACTTCCAGTTT
CGGACTCTGTATAGAGGAAACTCTGCCCTGCCGGATCCAT
CTGTGACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations