ZFIN ID: ZDB-TSCRIPT-090929-13121
Transcript Name: dab1a-002
Previous Name: dab1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031106 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031106|OTTDARG00000018486|ZDB-GENE-060528-1 dab1a|no_translation dab1-002 LG_none BX248232.11,BX085194.14,CT583664.7 Danio rerio protein_coding KNOWN, 2680 bp
GGATGTAGTCCAGGTCTGTGGCTGTCTGTCCCCGGCATGG
GAAAGTGGATTACTGCTCTTCTACAGACGGTAGAGACTGG
ATACGGAGTGATTGCGCGTGGATTTTTATCATGAGAAGTA
TGGAATCTGAACGCACTACTTTAAAGCCCTTGCTGGGAGT
GAATGCGATGCCGTGTCGAGGCTAGAGGCAGCGGTGGACT
GTTCCAGAGTCAGTGGAAAGCCCCTCTAGATGAGCCAGTC
ACAGCCACCCAGCTGCACGGTAAAGGAATAAGGATTTAAT
ATGTCAACAGAGGCCGAACTCCAGCCTGCTGCCAGACCCA
GCGTCAGAAAGGACTCCAAGAAGAGAGGGCAGGACCGCAG
TGAAGCAGCTCTGATAAAGCGTTTTAAGGGAGATGGCGTT
CGTTACAAGGCTAAGCTCATCGGGATAGATGAGGTCACTG
CAGCTAGAGGAGACAAACTCTGTCAGGACTCAATGATGAA
ACTCAAGGGAATCGCAGCCTCTGCGCGGTCTAAAGGAGAA
CACAAACAGAAAGTTTTTCTGACTGTGTCCTTTGGGGGGA
TCAAGATCTTCGATGAGAAGTCGGGGGTACTTCAGCACCA
TCATGCAGTTCATGAGATTTCCTACATCGCGAAGGATATC
ACGGACCACAGAGCCTTTGGATATGTATGCGGGAAAGAGG
GAAACCATCGGTTTGTGGCCATCAAAACGGCTCAGTCTGC
TGAGCCGGTGATCCTCGACCTCCGCGACCTTTTCCAGTTG
ATTTATGAGATTAAGCAGAGGGAGGAGATCGAGAAGAAAG
CTCAGAAAGACAAACAGTGCGAACAAGCTGTTTATCAGAC
GATTCTGGAGGAAGATGTGGAGGATCCCGTGTATCAGTAC
ATTGTATTTGAGGCGGGACACGAGCCCATCCGTGACCCAT
CAGAGGAGAGCATATATCAGGTACACTACCAGATTCCCTA
CCAGCCAACAAAAGGAGGGAGTTTATGACGTCCCAAAGCG
ACATCCAGTGAGAATATCAACCAGTTAGAGCTTTTTGGAG
ACATGTCCACCCCTCCAGATATCACATCGCCCTCGACTCC
AGCATCTCCGGCTAACACTCTGGACCCCTTGCTGGCCCAC
CAGACCCCATCCGAACTGTTCACCCCCTTCAACCCCGCCT
CTGTACCCTCAGGTTATGTGACGATGGGAGCCGTGCCACC
TGCGTGGGCGCAGCAACAGTTTGCTGCTCAGGCTCCATTA
GCGTTTGGCGTCCAATCCCCAGTGCAAGTTGCGCAGGTCT
TACCGGGCACTCAGCCTCTAATCTGGGGTCAAGCCAACCT
TTTCCCTGCCACTCAGCAGCAGTGGGCTGCGATGGCTGGG
GCTCACTTTTCTCCTGCCGCTTTCATGCCTGCCCAGACAG
TAGGACCACTTCCTGCTGCCATGTTTCAGACACTGGCTCC
TATGGCAGTGCCGGCATCCTGCGAGACGCCCACAGCGGCC
ATGGGTGGAGCCGTGGCAGGAACCTCGGCCTCCACGGCCT
CCAGTCCGCAACATGGAGAGCGCACACTGCAGAGACAGGC
AAAGATGAGCAAGGAGATGTTTAAGGAATTCCAGATGGCA
AAGCCACCGGCCATGCCTGCCAGGAAGGGCGAGCAGCCTA
GCCTATCCTGCACCACAGACGCTTTCTCCAGCTACTTCAG
CAGAGTGGGAATGGCGCAAGACACGGATGACTGTGACGAC
TTCGATATCTCGCAGATGAACCTCACACCCGTCACCTCCA
CCACACCCTCCACCAACTCACCACCCACCCCGGCCCCTCG
GCAGAGTTCTCCATCAAAGTCCTCATCCCACGCCAGTGAC
CCTCCCACCGATGACTCTTTTGGTGAGGCAGAGGGCAGCC
CTAGTCGGAGTGGAGAGGAGGATGCTGCTGGAGACTGTCC
GCAGTCTCCGGGTGCGAGTGAGCCTCAAGCAGAGCCTGAG
AGCTCAGAGACGGACAGTCCTCAGGGGAAGGACCCTCTTT
ATGCCCAGATCAACAAGGGGAAGAAGTGAAGCATCATGGG
AACTCTGCACAGACATGATCAGCGCTGGGGGGAGCAGGAG
ACCAAAAACACTGGAGATCTGTGTGTGTGTGTGAATGTGT
GCCCGTGTGTGTGCGAGTGTCACTCCAGCCTCAACGGTCC
ACTTCTCTAGAGCCGCCCGTCCCCCATCACCACGTCCTCC
GCCACTCTCTCCACGACACTTTGTTTCTTTCGCACTGTGT
TCAATGCACATGACAGCGGGGCATTGTGGGGGATTTTCGA
CCCTTCAGCACCCCTCATAGCCTTATGAGCCCAGCTCTGC
CGCTTCATCCATTCTCACGTTTCCTACTTCCAGTTTCGGA
CTCTGTATAGAGGAAACTCTGCCCTGCCGGATCCATCTGT
GACTTCTTCATCCATTTTCTTGGGGTTGGTTTGGATTTTC
CTCTCCTGCGTATTTGAGATTCTGCTGCTAGAAAGCTATG
CAGAGCTAAAAAAAATTTACCGAAAACAATATTTCGACGA
GGAGGAGCGACTTTTGCCAAAATCTCAAGATTTCGGAGCA
GCTGAATCTGACTGGGGGTCTCGAGGGTAAGGACGTTTGC
TAAAAACGAGTGATCAAACTGTTCCTTCTCTATAGCTTTT
GTACAATACTAATGAGAAAAAAAACAAAAACAAAAAAAAA

dab1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dab1a-205 (1)    Ensembl 2535
ncRNA dab1a-002 2680
dab1a-004 (1)    Ensembl 2168
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dab1a-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031106 (1),  Ensembl_Trans:ENSDART00000143936 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ166811 (1) 2680 bp
CITATIONS (2)