Transcript

cnbpa-204

ID
ZDB-TSCRIPT-090929-22072
Name
cnbpa-204
Previous Names
  • cnbpa-004
  • zff9-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042341 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042341|OTTDARG00000030555|ZDB-GENE-030131-5045 cnbpa|OTTDARP00000033686 zff9-004 LG_ CU571070.6 Danio rerio protein_coding KNOWN, 765 bp
TTTAAGACGGGGCTCATTTACTTATTTTATACCTTCGTTG
ATTGTGTTGATTGCATGGTCCGTGTGCGCAGTGAGTGTGT
GTAATCGCTTGCGTTCAGCTAGCTGAGGCCTGCTGCAGCT
CATGCCTGCGCGGGAAAGTCTCTTATAAGTGCACGTGCAC
AAATGCATTTCCGAATGTAAAACTCACAGCAAGATATAAA
AACGCACACCACGGCAGACTAGTGATGGCATTCGATGTAT
TTCGTGATACTTTAGTGTAAACGTGCACGAAGAGGCCCAG
TGTTGAGGTTTGAGGTCTGGAGCGTTTGCATGTGGATTTC
CTTAAACATCAACAAAAACCACTCAGTGGTTGGCATTCTG
AAGTCAAAGTTTGTTGCTTGGTCCCTGCAGAATGGACATG
AGTACCAGTGAGTGTTTTGGATGTGGCCGTTCTGGACACT
GGATCAAGAACTGCCCTAATGCTGGTCGCGGTCGTGGCAG
GGGCCGAGGACGAGGAAAGGATCTGTTCTGTTACCGGTGT
GGTGAGCAGGGACACATCGCCAGAGATTGCGAACAGACTG
AGGATGCGTGCTACAACTGCCACCGGAGTGGCCATATTTC
TAGAGACTGTAAAGAACCCAAAAAGGAGCGAGAGCAGTGT
TGTTATAACTGCGGTAAAGCTGGTCATGTGGCACGCGACT
GTGACCATGCCAACGAGCAGAAGTGCTACTCCTGTGGGGG
CTTTGGGCACATCCAGAAATTATGTGACAAGGTGAAGTGT
TACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations