Transcript

cnbpa-202

ID
ZDB-TSCRIPT-090929-22071
Name
cnbpa-202
Previous Names
  • cnbpa-003
  • zff9-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042340 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042340|OTTDARG00000030555|ZDB-GENE-030131-5045 cnbpa|OTTDARP00000033685 zff9-003 LG_ CU571070.6 Danio rerio protein_coding KNOWN, 1060 bp
CACATATTGTTGTCTTTAAATTCTCAATTACAACATTGTT
TTTGTTCATTTTAAGACGGGGCTCATTTACTTATTTTATA
CCTTCGTTGATTGTGTTGATTGCATGGTCCGTGTGCGCAG
TGAGTGTGTGTAATCGCTTGCGTTCAGCTAGCTGAGGCCT
GCTGCAGCTCATGCCTGCGCGGGAAAGTCTCTTATAAGTG
CACGTGCACAAATGCATTTCCGAATGTAAAACTCACAGCA
AGATATAAAAACGCACACCACGGCAGACTAGTGATGGCAT
TCGATGTATTTCGTGATACTTTAGTGTAAACGTGCACGAA
GAGGCCCAGTGTTGAGGTTTGAGGTCTGGAGCGTTTGCAT
GTGGATTTCCTTAAACATCAACAAAAACAATGGACATGAG
TACCAGTGAGTGTTTTGGATGTGGCCGTTCTGGACACTGG
ATCAAGAACTGCCCTAATGCTGGTCGCGGTCGTGGCAGGG
GCCGAGGACGAGGAAAGGATCTGTTCTGTTACCGGTGTGG
TGAGCAGGGACACATCGCCAGAGATTGCGAACAGACTGAG
GATGCGTGCTACAACTGCCACCGGAGTGGCCATATTTCTA
GAGACTGTAAAGAACCCAAAAAGGAGCGAGAGCAGTGTTG
TTATAACTGCGGTAAAGCTGGTCATGTGGCACGCGACTGT
GACCATGCCAACGAGCAGAAGTGCTACTCCTGTGGGGGCT
TTGGGCACATCCAGAAATTATGTGACAAGGTGAAGTGTTA
CAGGTGTGGTGAAATCGGACATGTGGCGGTGCAGTGCAGC
AAGGCCACTGAGGTGAACTGCTACAACTGCGGCAAGACCG
GTCATCTGGCGAGAGACTGCAGCATCGAAGCGTCTGCGTA
GCTCCTTTTCCTCTGTCACTTCCTCCTTTCCTGATTGATG
GTTGTTTCTCTTCTCTGAATCCTCTTCATTGGCCAAAAGC
TGGCAAACAGAGGCCTTCCCGGGCCAGTGAGCAGATATGA
GTTTGTTTTTCCTTCGTTATAAAGTAAAAGGGGTGGAAAA
ATATCTTATTGCGTTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations