Transcript

synpo2b-201

ID
ZDB-TSCRIPT-090929-21552
Name
synpo2b-201
Previous Names
  • synpo2b-002
  • si:ch211-108g16.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041505 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041505|OTTDARG00000030094|ZDB-GENE-101230-1 synpo2b|OTTDARP00000033150 CH211-108G16.2-002 LG_ BX927100.9 Danio rerio protein_coding PUTATIVE, 833 bp
GGCAGAGCGGAGGGGGAAAGTCTCCTTGACGGTGCAGACC
AGACTCAGCAGACACCAAGCAAGACAGGACTAAAATGGAG
ATACAGTTGGCATGACAGCTGGAAAAAAGTCAACCCTAAA
TGTAAAAATAACACTGCTTTTTACTGTGGCCAACAGCAAG
AGGGTGTTGATTTTTAAGACGTGTCAACAAAAGGGTCAGA
AGGTAACACTGGTTAGCCACAGTATATCTAAATGACAGAT
TTCGGGACAGGAAAGACATTGTACACCACAAAGTAAGTCA
GGATTTACACTCTCATCAAAGACATTTCAATGCTCAGAAA
CAAAGTACCACTTTGAGCTACATCAGAATATCTTATTATT
AACTAAATAACTTTGAGACAATGGAGCATCTTCCACAGAC
AAAAGGCAAAGGAGTTTTGATGTTTGCCAAGAGGCGTCAA
AGGATGGATGAGATTTCTGCAGAACATGAGGAAATGAGAC
GAAAAGGCATACCAGTTGATGCAATTGAGGAAACAAAAAG
GGAAATTGTGATGCCTCCTCCTCAAGAAAGTAAACAATCC
CCACAAGATTTCTATGCAAGGCAAGAGAAGCATTATCAAG
GGCAGCCATTTCAGCTACAGATGTTGCAACAATCAGCAAA
CAGCATGAATGGTCTGGATCCACACCAAGGTTCGGCTGTT
CCAAAACCCCTTGTGTCCAACAGAACTGCTAAACCCTTCT
TTAGCGGTCATAATCAAGGCCAAAAAACTTTTTCACCAGT
TAGAGGTGTCTCAAGCCCAACATCTAAAAAACCTGAAAAC
ATATTCAAGGTTCCTATTCCGGTAAACACAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations