Transcript

synpo2b-202

ID
ZDB-TSCRIPT-090929-21551
Name
synpo2b-202
Previous Names
  • synpo2b-001
  • si:ch211-108g16.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000041504 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000041504|OTTDARG00000030094|ZDB-GENE-101230-1 synpo2b|OTTDARP00000033149 CH211-108G16.2-001 LG_ BX927100.9 Danio rerio protein_coding PUTATIVE, 3141 bp
GGAAAGTCTCCTTGACGGTGCAGACCAGACTCAGCAGACA
CCAAGCAAGACAGGCACGACTAAAATGGAGATACAGTTGG
CATGACAGCTGGAAAAAAGTCAACCCTAAATGTAAAAATA
ACACTGCTTTTTACTGTGGCCAACAGCAAGAGGGTGTTGA
TTTTTAAGACGTGTCAACAAAAGGGTCAGAAGGTAACACT
GGTTAGCCACAGTATATCTAAATGACAGATTTCGGGACAG
GAAAGACATTGTACACCACAAAGTAAGTCAGGATTTACAC
TCTCATCAAAGACATTTCAATGCTCAGAAACAAAGTACCA
CTTTGAGCTACATCAGAATATCTTATTATTAACTAAATAA
CTTTGAGACAATGGAGCATCTTCCACAGACAAAAGGCAAA
GGAGTTTTGATGTTTGCCAAGAGGCGTCAAAGGATGGATG
AGATTTCTGCAGAACATGAGGAAATGAGACGAAAAGGCAT
ACCAGTTGATGCAATTGAGGAAACAAAAAGGGAAATTGTG
ATGCCTCCTCCTCAAGAAAGTAAACAATCCCCACAAGATT
TCTATGCAAGGCAAGAGAAGCATTATCAAGGGCAGCCATT
TCAGCTACAGATGTTGCAACAATCAGCAAACAGCATGAAT
GGTCTGGATCCACACCAAGGTTCGGCTGTTCCAAAACCCC
TTGTGTCCAACAGAACTGCTAAACCCTTCTTTAGCGGTCA
TAATCAAGGCCAAAAAACTTTTTCACCAGTTAGAGGTGTC
TCAAGCCCAACATCTAAAAAACCTGAAAACATATTCAAGG
TTCCTATTCCGGTAAACACAACACCAAACGTTTGGTCTCC
CACATCAGACGTTATTGCCTCTCGTGATGAACGTATTGCC
ATTCCTGCTATTAAGACAGGGATCTTGCCAGAAACAAAAA
GGAGAGGAGCAAACAAGACAGACTTAAAAGAAAGGCCTCT
ACATCAGAAGAAAAGAGATGAAAAGTCCTTAACAGAGTTC
GTTCAAGAGGAGGACCTTCTCAGTCTAGGCGCTGAAGCAT
GCAATTTCATGCAAGCTCCAACAGTCAAGCAGAAAAATCC
TCCACCTGTCCTACCCAAACCTGTTATCAACCCAGCTCAC
CCTCTCTGGTCTGCAGATGGTCATGCCGTTTCAACGAGCC
TCCTAATGACATCAAGTTCAGCTCAAGCTATGGGGCACAA
TCAGGTGCAGGCGGGCCATACAAAACAGCACCCTGCTGCA
GCCTGGACTCCAGAACCACATCAGACACCACATAAACTTC
GTGCTGGTCCCTCCAAATCCAAAACCCCATGGATAAAGTC
ACAAAGTGAAGAGAACTCTGTTGCTTCCTGCCCACCCCAA
CATCTTAGCACATACCTTCCAGCATCAAAGGCCCCATCAG
CTTCTCATCAAGAGTATTCATCAGAAACAGGTGCATCTGA
GGGTCTGAACCTTAAAGGAAAAGGAGCTGAACTGTTTGCA
CGGAGACAAACTCGTATGGAAAAATTCATTGTGGACAATG
AGACTGTGCGAACCAATAAGGTCAGACCCTCATCACCAAC
GCTCTCAATGCCAAGCACCTGGAAATACTCTTCTAACATC
CGTGCACCACCTCCAGTGTCCTACAACCCTATTTTATCAC
CCTTTTATCCCCTTGCAGCAGTTAAACAACCCCCACCTGC
GACTAGTCCAAAGACAAAGCCGAAGGTAAACAAGGAGAAG
AAGAATCCTCCCCCCAAGCATCTCAATGTTCTGGATGTCA
TGAAACATCAGCCTTACCAGTTGGATTCCTCCCTATTCAC
CTACAACTTTACACCAGAGGTTGAAGAAGCAGTTTCTCCT
AAAGACTCAAAGCCAACTTCAGCAAATAGTTCTTCCAAAA
TTTCACAAACAGATAAGCAAAATCCATCTAAAGCCACTGG
AGAGGTAAGTGCTGTATACCCGTTTGTCCGCCAGACTACA
TCAAATGAGACTGCTGCTGTTGCCCCACAACAATTAGATG
GAAAACAACTTAACATGTATGATGGTACTAGAAACAAAGG
CATCTTCAGTGTCCGTCTGCCTCCTGGTAGCTCTGGTGGC
AATGTTTCTGTAGGATCTTCTGCACTTGAAAATAATCAAT
ATGCTTCACGATCTGTATTACCAGTTGCCCCAAGACCAAA
GTTTTCAGCCAAAAAGTCGAACATGACAGGCAAGCAATGG
AAACCGATGATTCTGCAACATTAATTGAGCTTTAAAAGGG
TCATGACATGGTGTTAATTAATTAAAATTTAATTTTTTCA
TTCACATGGTCATTAAAATACTTTTAATTATTGCTTTTTA
GGTTAATGCGTGTTTCTTTTGAGCTCAACGCATAATACTT
GCAAATATTTCTGTGATTTAGGGTATAAAATGATTTGATT
AGATTAATATTCTTGATTTTATTAGCTTCACAATTTTCTT
GTTATGTTTCCATGTGATACAAAATGGGAGTTGAATTTAT
TTTTAAACAGTTTTTTTTTTCTTTTTTTTAAATAAGAGTT
TTGGCAAATATCAAACCTGTTTCCTTTTCCCAATGAAAAA
ATATTTGCTAGCATTAAATGCTATGTTTAGGTTCAGTGTC
AGAGCAATACACTAAAAATGCATCCCTCTTTTGCTATATC
ATTAGATATTAGGTTTGGAACTTTTTCACAGATTGCATTT
CAACAAGGTTGTATTTTAGACTTCATCAGACATTTTTTTA
ACATTGTTTTATTTAGTTTTCTTTGGAAACTCAGGCCAGC
CTAAAATATAATTCAGAGATATTTACTATTATTATGTGCT
TTGTAAATTATAAACTATTTGTAATGTGTTTAGCAGACCC
TTCTGTTCAAATACTGAGAAAAATACGTATGTATAAAATT
TGCTCATTCATTTGTCTCAAGTCAAATATGATTGAACTGT
ATTACTACTTTTCTGGTTTCTTCTTTTCTTGATATTTCAA
AACTACTGCATTGCCTGATCCTTCACTTTAATAAAATTTT
CCATCTTTCTTTGCTTTATTTGTCTTTTTTGATCTTTCCC
GCATTTCACCACAGCTCATTTTCTACACACATCCACTTGT
CCTACAAAGACACATTGTAGTCTTTAACGGGTCTAGTCTT
TATTCTGTGTGGCTGATTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations