ZFIN ID: ZDB-TSCRIPT-090929-20888
Transcript Name: col17a1b-203
Previous Names: col17a1-002, col17a1b-002, si:ch211-223p8.6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040783 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040783|OTTDARG00000029669|ZDB-GENE-030131-7145 col17a1b|OTTDARP00000032593 CH211-223P8.6-002 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 510 bp
TCTATGGCTTCCACAATAATTTAGCTCCTTCCACTGGAGT
CCTAACGTCCAGCGGAGTTAACACACAATCAGGATATGGA
GTGCAGAAGAATTATTCCTCAAGTCCAGACAGCACTCTTG
CAGTCAGCACAGGCATCTCCACTGCAGGTTATGGAGTGCA
GAAGAATTATTCCTCAAGTCCAAACAGCACTCTTGCAGTC
GGCAAAGGAGTCTCCACTGCAGGAACTGGTTCAAGGACAT
TTAATGAGAATGTGTCGAAGAGATACCTGGTGATGGACAA
GGAAAACATTCCAGCGAAGAGAGAAACTGACGAACTGATC
CTGACCAAAGACAGTGGCAAACTTTTTAGCAACAGCGCCG
CCAACGGGTCAGCAGATTCATATTCAGATGTTTCGGTGAA
GAAAGAGACCCTGATGACCAGCTATTCCGAAAGTGCTCCT
ATCAAGTCTTATTCTGGCACACAATATGGATCTGCATCAG
TGTCAACAAAAGATAAAGCTACATATGCAG

col17a1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col17a1b-202 (1)    Ensembl 4533
col17a1b-203 510
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col17a1b-203 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040783 (1),  Ensembl_Trans:ENSDART00000137074 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN897416 (1) 551 nt
CITATIONS (2)