ZFIN ID: ZDB-TSCRIPT-090929-20881
Transcript Name: col17a1b-202
Previous Names: col17a1-001, col17a1b-001, si:ch211-223p8.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040776 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040776|OTTDARG00000029669|ZDB-GENE-030131-7145 col17a1b|OTTDARP00000032587 CH211-223P8.6-001 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 4533 bp
AGACAGAAATCAGGACCAGACTACAGAGCGCATCTCCCTC
AACTAGATGGACGGAGCTGGATGATGTAAAGAAGTTGTTG
AAGACCTCTCGCTCCGCTAGCGTCAGCCCCACACGATCAC
CCTCCTCATCCCCTCTGCCAATCCCACGCAAGGCTACCAC
CTTAGACACCAAGACCTCCAGCAAACAAGTGGAGCAATAC
GACAGCAGTTTTCTCGAAGCAGATCTGGCCTCATACACCT
GGAACAGCTCCACACTACCCTCTGCAGTCTCCACTGGCAC
CGCCACTGCTTATGGCTTTCAAAGTAACACCAACAATATG
GCAACTGGAGCTTCACTGATCAGCAGCAGCACATCCCCAT
CCTCCTTATCAGTCTATGGCTTCCACAATAATTTAGCTCC
TTCCACTGGAGTCCTAACGTCCAGCGGAGTTAACACACAA
TCAGGATATGGAGTGCAGAAGAATTATTCCTCAAGTCCAG
ACAGCACTCTTGCAGTCAGCACAGGCATCTCCACTGCAGG
TTATGGAGTGCAGAAGAATTATTCCACAAGTCCAAACAGC
ACTCTTGCAGTCAGCACAGGAGTCTCCACTGCAGGTTATG
GAGTGCAGAAGAATTATTCCTCAAGTCCAAACAGCACTCT
TGCAGTCGGCAAAGGAGTCTCCACTGCAGGAACTGGTTCA
AGGACATTTAATGAGAATGTGTCGAAGAGATACCTGGTGA
TGGACAAGGAAAACATTCCAGCGAAGAGAGAAACTGACGA
ACTGATCCTGACCAAAGACAGTGGCAAACTTTTTAGCAAC
AGCGCCGCCAACGGGTCAGCAGATTCATATTCAGATGTTT
CGGTGAAGAAAGAGACCCTGATGACCAGCTATTCCGAAAG
TGCTCCTATCAAGTCTTATTCTGGCACACAATATGGATCT
GCATCAGTGTCAACAAAAGATAAAGCTACATATGCAGAGA
TCCACAAAGCAAAGCTTGAGGACGAGGAGGACGACTGTAA
GTGTGGAGGGGGTCTGTGTGGTTGTGGCCCGAACTGCTGC
TCTTGGTGGAAGTGGCTGCTGGGCTTTTTGCTCGGACTCC
TGCTGCTCCTCGGCCTTCTGTTTGGACTCATTGCTTTATC
TGAGGAGGTAAAGAAGCTCAAGTCTCGTGTCAGCACTCTT
GAGGCAATGTCCTCCTCCATGAATGCCCACACAAGCCGTC
TGTCAGCTCCAATTGATGGCATTGATGAGGTTGGAAGTAA
AGCGGCGTATGTGAATTCACTGGATTCTGCGGTTAATTCA
GACAACATTGGACTGCAGAGAAATGTGCAGCAAATAGTGA
GAGCAGAGATGCAGTCCGAACAAATGAGAGCCTACCTTGC
TTCTTCTGTCAAAGCTGAAAGAGGACTTCCAGGGCCTAAA
GGTGACTCTGGATCTCCAGGAACTAGGGGAGACAACGGTT
TTCCAGGGATACCAGGTCCACCAGGAATGCCAGGACATTC
AGGAAGGGACGGACAAAAAGGAGAAAAAGGAAGTGCAGGT
GAACATGGTGCAGAAGGATTCAGGGGAAGAGATGGTCAGC
CTGGACCTCGTGGAGAGCCTGGGCCCCCAGGAGCCGGAGA
GAAGGGTGAAAGGGGTAGTCCTGGCCTTCCTGGTCTCATT
GGTCCACCTGGGGCAAAAGGCTCTAGTGGTTTACATGGTG
AACAAGGCCCTCAAGGCTTCAGAGGAGAGCCTGGTCCTGC
TGGGCCAAAAGGTGATAGAGGACTTCCTGGTCTACCTGGA
ATTAAAGGTGATCATGGCGATAGAGGAGAGAATGGGTTGC
CAGGCATTCCTGGAGTTGTAGGACGACAAGGACCAGCTGG
AGAGAAAGGAGATAAAGGATCTGCAGGGCCTCAAGGAGCT
GATGGTGAAAAGGGTCAGAGAGGTGAGCCAGGATCAATTG
GCTTACCAGGAATCAGAGGACCACCTGGGCCACATGGTGA
TCCTGGTCAATCAGGAGCCCCAGGGATTCAAGGACCTCCA
GGCCTACCTGGCAATCCTGGTCAGCCTGGACCTAAAGGTG
AAACTGGTGAGGCTGGAAGAGTGATCAATGCAGCAGGTTC
CACCTCAGTGGCAATCCCAGGACCGCCTGGGAGCGCTGGT
CCTCCTGGCCCACCTGGATCTCCAGGACTCTCAGGTCCTG
TTGGCCCTGCTGGACTTCCTGGTCCCCCTGGTGTTAAAGG
TGATAAGGGAGATCAAGGAGAGCCAGGTATTGGTGTGAAC
ACTGGTGAGACTTTGGTTTCAACCAGAGCAGAAAGACAGT
ATGGTGCTGTTAATGTTGGTGGTACTGGACTACCTGGTCC
TCCTGGTCCACCAGGGCCCCCTGGACGTCCAGGGGATTCC
AGACCAGGTCCACCAGGACCACCTGGTGAGCCAGGATATG
GCAGACCTGGTCCTAAAGGAGAAAAGGGAGAGCCAGGAAA
CTTTGTGCCTAATTCAGGCACATTTTTTGCAGGACCACCT
GGGCCGCCAGGGCCCACAGGGCCTAAAGGACCAACGGGTC
CCCAAGGTCCACGAGGATACACAGGAGAACCAGGACAGCC
TGGCCTTCCAGGGAGTTCCGGAAGAGTTATTTCTGAGTAT
GGTGTGGCTCAAGGGCCACCTGGTCCCCCAGGACCTCCTG
GACCACCCGGTCGAGAAGGCCGTAAAGGAGATCCGGGAGT
ACCAGGTACTTCTACCTTCCAAGGAGAGTCAAGAGTTGCA
GCTACACACCAGGGACGGCCTGGTCCTCCGGGACCTCCAG
GTCCACCAGGTGCTCCAGGTCAATCCAGTGGATCTGCTGC
AGATTATCGTCGTTACATCATGGAGTATATGCAGAGTGGC
AGCATGAGGCAGCATTTGTCTGGTATTCAAGGGCCGCCTG
GTCCACCTGGGGCTTCAGTGTCAGTAGAGGATGTGGCATC
TCGGGTCATAGCTTACATTCAGCGCTCTGGAATCAGTGGT
GGCAGCATTAGCCAAAGTGCTCAAGGTCCTCAAGGTCCCC
CAGGACCTCCTGGTCCACCTGGAAGCATAACTGCTGATTA
CATCATATCACTTTTACAGAGAGATGATGTAAGGCGTTAT
GTTGCTGGACCTCCAGGGCCACCAGGTTCACCGGGGATTA
GTGGTAGTTCCTTTAACACACAGGAAGTTGCAAACTATGT
CATGAGAATGATGAATGAACAGGGAATGATAGGCAGAGCT
GGACCACCAGGCCCTCCAGGACCACCTGGCCAGCCTGGTG
CCACCTACAGTGACATAACTGCTCTGATTCAGAGGTCAGG
GATTGGTGGAAGCATTGGACGTCCAGGGCCTCCTGGTCCT
ATGGGACCACCTGGTCCACCCGGTGCCTCAGGAGGCAGTT
CCTCTGCAGTCTCAGGTTATTCACTAGAGGACATCCAGCG
CTACCTGCAAAAATCTGGTTTTAGGGGACCTCCAGGCCTA
CCTGGTCCAGCAGGACCCCAGGGTCCTCCAGGAGACACAA
GGAGCCTTGTATCATATACAGGATCTTCTGCTCGAGAACA
GATCCGTACTGAACTGCAGGACTACCTAAACAGTGACACT
ATGAGGCGCTATGTCCAAGGGCCACCTGGGCTGCCTGGAC
CCCCTGGTCAGAAGGGTGACCGTGGTGAACCTGGGTACAG
TTATCAAAATGGCAGAAACCAATATCGCTATGGCACTGAA
ATCAGTGAACCAGTGGACTACTCCAATGTTGCACTAAAAG
TGACTGATTACATTAAGGATCAAGGTCTGCTGCAGGACCT
GACAGAGGGATACTGGAGGTCACAAGCAGGAAGCATTCAA
GGACCCGCTGGGCCTCCTGGTCCTCCTGGCCCACCCGGGT
ACAGCCGTGTGATTGGTGCCTATGGGAACGTGACAGCTGA
TCTCATGGACTTCTTTAGAACATATGGGACAATCCCAGGG
CCCCCTGGCAGGTCAGGGCCCAAAGGAGAAAGAGGATATC
CAGGACCTAAAGGAAATAAAGGGGACACAGGGAGCTCGGG
GATACCTGGCCTACCAGGACAAAGAGGACCTGAGGGACCA
AGGGGAGAAAAGGGTGAAAAAGGAGAGATCCAGACTGGCA
GATGGATACGAGCAAACGGCGTGTAAAGGCTCAAGGATTT
GCTGAAGCACAATTTTGTGGATGCACTGACAGCATAAAAG
AAATTGTTCATGTTTTTAAGAAGATAAATGGATAAACTAG
TCTCTCTTTATGAAGTAATGCAGCTTAGAGGCTTGTTTGG
TACTTATTTACCACAATATACAGTTTTATAATCAAACAAA
TGCATGCAAAATAATAATCCATACATTCAAAACTACTTCC
AGGTTGACAACAATTATTTGTCTTCATTATATAATATTTA
ATTCATTGTAGCACTTAAAATGTATACTTGTCACCCAATA
GTGGGCTTTGTAGTTGTATTATTACTATTATTATTTTTTT
TGTTTTGTACTGTACAATTTTTTTTCTATGAAACAAAAAA
TGTACCTTAAACAGCTGAGATTGTTTTAAACGTACCAAAT
AAAGATCCATTCA

col17a1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA col17a1b-202 4533
col17a1b-203 (1)    Ensembl 510
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
col17a1b-202 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040776 (1),  Ensembl_Trans:ENSDART00000134102 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK024897 (1) 1181 nt
GenBank:EV760426 (1) 1001 nt
GenBank:CK029146 (1) 774 nt
GenBank:DN895633 (1) 726 nt
GenBank:CF347777 (1) 716 nt
GenBank:EB901238 (1) 611 nt
GenBank:BE200663 (1) 601 nt
GenBank:EB955785 (1) 596 nt
GenBank:EB953483 (1) 561 nt
GenBank:EB937045 (1) 470 nt
GenBank:EB917071 (1) 459 nt
CITATIONS (2)