Transcript

slka-003

ID
ZDB-TSCRIPT-090929-20887
Name
slka-003
Previous Names
  • slkn-003
  • si:ch211-223p8.7-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040782 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040782|OTTDARG00000029673|ZDB-GENE-050411-66 slka|no_translation CH211-223P8.7-003 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 556 bp
GTTAATCTATTCTCTATTTCTTTCCTTTCATGAATCTTTT
TCCATTTATCATGAATTATCAATGTTTTATCTTTGTTAAA
TGGTTTAAGTGTGACTTTCCTCTTAATGCTGTGGTATCAG
TGCTGTGATTAGTGTTCATATTTGACTGCTTCCCCTTGGA
GCATGATCATATGCAGAGACTAATTCAACACATCCCCCTT
TGTTTCTGCACCCGATCCTCCTCTCCCTCTCTCTTGTTCT
TCCTCTACTGTCTGACAGGAGCAAGAGTTTCTCCAGAGAC
AGCAGCAGGAGCTGGATGGAGCTCTGAAGAAGATCATCCA
GCAGCACAAACTGGAGATCGCCACTATAGAAAGAGACTGT
CTCAACCACAAGCAGCAGCTCATGAGAGCAAGAGAAGCAG
CCATGTGGGAGCTGGAGGAGCGCCACCTGCAGGAGAAACA
CCAGTTACTGAAGCAGCAGCTGAAGGATCAATACTTCATG
CAGAGACATCAGCTCCTCAAGAGACATGACAAGGAGATGG
AGCAGATGCAGGGTTATAACCAGCGGTTGATTGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations