ZFIN ID: ZDB-TSCRIPT-090929-20887
Transcript Name: slka-003
Previous Names: slkn-003, si:ch211-223p8.7-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040782 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040782|OTTDARG00000029673|ZDB-GENE-050411-66 slka|no_translation CH211-223P8.7-003 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 556 bp
GTTAATCTATTCTCTATTTCTTTCCTTTCATGAATCTTTT
TCCATTTATCATGAATTATCAATGTTTTATCTTTGTTAAA
TGGTTTAAGTGTGACTTTCCTCTTAATGCTGTGGTATCAG
TGCTGTGATTAGTGTTCATATTTGACTGCTTCCCCTTGGA
GCATGATCATATGCAGAGACTAATTCAACACATCCCCCTT
TGTTTCTGCACCCGATCCTCCTCTCCCTCTCTCTTGTTCT
TCCTCTACTGTCTGACAGGAGCAAGAGTTTCTCCAGAGAC
AGCAGCAGGAGCTGGATGGAGCTCTGAAGAAGATCATCCA
GCAGCACAAACTGGAGATCGCCACTATAGAAAGAGACTGT
CTCAACCACAAGCAGCAGCTCATGAGAGCAAGAGAAGCAG
CCATGTGGGAGCTGGAGGAGCGCCACCTGCAGGAGAAACA
CCAGTTACTGAAGCAGCAGCTGAAGGATCAATACTTCATG
CAGAGACATCAGCTCCTCAAGAGACATGACAAGGAGATGG
AGCAGATGCAGGGTTATAACCAGCGGTTGATTGAGG

slka TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slka-203 (1)    Ensembl 362
slka-204 (1)    Ensembl 4982
ncRNA slka-003 556
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slka-003 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040782 (1),  Ensembl_Trans:ENSDART00000135796 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB889771 (1) 556 nt
CITATIONS (2)