ZFIN ID: ZDB-TSCRIPT-090929-20886
Transcript Name: slka-203
Previous Names: slka-002, slkn-002, si:ch211-223p8.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040781 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040781|OTTDARG00000029673|ZDB-GENE-050411-66 slka|OTTDARP00000032592 CH211-223P8.7-002 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 362 bp
CTGGTGTGTGTCCCCTGTTCCTGACGTGGTGGAGTTGGCT
GTGTTTTACTCCACAGGGTGTGGCCCAGGTTATGATACAG
TCTTTTCAGTTGTCCTCATGTGCTCTGTTCAACGCTCAGA
TGCAGGATGAGCAAGAGTTTCTCCAGAGACAGCAGCAGGA
GCTGGATGGAGCTCTGAAGAAGATCATCCAGCAGCACAAA
CTGGAGATCGCCACTATAGAAAGAGACTGTCTCAACCACA
AGCAGCAGCTCATGAGAGCAAGAGAAGCAGCCATGTGGGA
GCTGGAGGAGCGCCACCTGCAGGAGAAACACCAGTTACTG
AAGCAGCAGCTGAAGGATCAATACTTCATGCAGAGACATC
AG

slka TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slka-203 362
slka-204 (1)    Ensembl 4982
ncRNA slka-003 (1)    Ensembl 556
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slka-203 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040781 (1),  Ensembl_Trans:ENSDART00000136177 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)