Transcript

slka-204

ID
ZDB-TSCRIPT-090929-20885
Name
slka-204
Previous Names
  • slka-001
  • slkn-001
  • si:ch211-223p8.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000040780 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000040780|OTTDARG00000029673|ZDB-GENE-050411-66 slka|OTTDARP00000032591 CH211-223P8.7-001 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 4982 bp
ATGTCCTTTTTCAATTTTCGGAAGATATTTAAGTTGGGAA
CGGAGAAGAAGAAGAAACAGTATGAGCATGTCAACAGAGA
CGTCAACCCCGAGGATTTTTGGGAGATCGTGGGAGAGCTT
GGGGATGGAGCCTTTGGCAAAGTCTACAAGGCTCAGAACA
AACAGACTGGGATCTTGGCTGCAGCTAAAGTGATCGATAC
CAAAACAGAAGAGGAGCTTGAGGACTACATGGTGGAGATC
GACATCCTCGCCTCCTGTGACCATCAGTATATAGTCAAAC
TGCTGGATGCTTTCTATTATGAGAGCAAACTCTGGATTCT
CATTGAGTTTTGTGCTGGAGGAGCGGTAGACGCTGTGATG
TTGGAGCTGGAGCGGCCACTGACAGAGCCTCAGATCCGGG
TGGTGTGTAAACAGTCGCTGGAGGCGCTGGTTTACCTCCA
TGAGAATAAGATTATACACCGGGACCTGAAGGCTGGAAAT
ATTCTCTTTACCTCAGATGGAAACATCAAATTGGCTGACT
TTGGAGTGTCTGCAAAGAATACAAAGACCCTACAGAGAAG
AGACTCTTTCATTGGAACGCCATACTGGATGGCACCCGAG
GTGGTGATGTGTGAGACGTCAAAGGACAGACCATACGACT
ACAAAGCGGACATCTGGTCCCTGGGGGTGACGCTGATTGA
GCTGGCACAGATCGAGCCACCCAACCACGAGATGAACCCA
ATGAGAGTCCTGCTAAAAATAGCAAAGTCTGAGCCCCCCA
CTCTGGCATCTCCATCACGATGGTCTCCTGAGTTCAGTGA
TTTCTTGCGGAAAGCACTGGATAAGAATGTAGACAACAGG
TGGAGTGCCTTGCAGCTTTTACAGCATCCATTTGTTTCTA
GTCTAGTGGATAACAAACCACTCCGAGAACTAATTGCTGA
AGCTAAAGCCGAAGTGTTTGAGGAGTTTGAAGAGGGAAAA
GAGGAAGAGGAGGAAGAAGAGCCCGAGCCCCAATCGGCAG
TGCAAGGACACAAACGTGCATTATCAGACACCAGTGTTGG
CAGCTCAGAGGATGAGAGACAAAATCAGAACACGCCAACT
CTCGAGTCGGTCACAGAGAGAGCTGAACCTGAAAGAAAAC
CTGAGGATCGAGCTTGTGACAAGACATCTGCCATGGTGGT
GGATGCTAACGAATCTAACCATCTTGAGGATGGGAAGATA
GTTGAAGCCAATGTTTCAGACACCAGCGCTGAGGAATTAC
GTTCTGGTGATGAGCTCATATCAAAGCAAGAAGAATCTCC
TATGCCAGTTAGCACAGAAGGGGGGGTTACTGATCAGCCG
AATGCTCCAACAGCAAATGACACTAACCTCCAAGAGATTG
TAACTGTCAGTGAGGAAACTGGTGAGGAGGAAAAGAAAGA
AGTGAAGGTGGAAGAGAAACTAGAGAAGAAAGAAGAGGAG
TCTGAAGAAATTAATATGAAAGCCAAAGCACAAAGCATTA
CAGATGAAGAAAAGGAGCATGCCTTACCTTCAGATGAGGC
TGAACCGAAGAATAAATCCGATGGTGTTACTGAAGAAGCC
ATTACTGAACTAATTGAAGTTACAGAAAAAACTGAAGACA
AGCTTGAGAATGAAGAAGAGGTGCATGGAAAGGAACCAGA
AGAAGATAAGACAGTTACCTCAGCTGATGTTCCTACAGAA
AAATTGAAGGAGCAAACAGAAACTTTACCAGATGTTTCTA
CAGAGGAAGTAAAGAAGGAGCAACCGGAAGCTTCACCAGA
TGTTTCTACAGAGGAAGTAAAGGAGCAACCGGAAACTTTA
CCAGGTGCTTCTTCAGAAGAAGTAAAGAAGGAGCAACCGG
AAACTTTACCAGATGCTTCTTCAGAAGAAGTAAAGAAGCA
ACCAGAACCTTCACCGAAAGGTTCTACAGAAGAAGTAAAA
GAGGAGCAACCGGAGACTTCACCAGAAGTTTCTAAAGAAG
TAAAGGAAGATCAGTTGGTCCCAGAGGACCAAAATAAAAC
TGAAGAAAAGGCTGAGATTACAGAACCCAGGGGGGTAGAT
GTGGTAGAGGACATCTCTCTGAGTAAAGTTCCTGTTGTTG
TCATTAATGGTGTGAAAGAAGAGGAGGTCAGTGCTACAGA
AGAACCTGCAGAAGCCCCTGAAGACAGACCAGAGATCCAG
GAAGCCCCTGCCATGCCTGAAAGTGACCACAATACAGTAG
ATGTGGCAAAACCAGATGCCGAAAAGGAAAAAGACTCCGA
TTCAGGCAGCAGTTCTGCTGCAGATACTAATAGCATTGAT
ATTAATCTGTCCATTTCCAGTTTCCTTTCCAAGAGCAAAG
AAGGATCTGTTTCAATACAGGACATCAAACGCCAAAAGAA
AACCCTGAAAAAGACTCGCAAGTTTTTGGTCGACGGGGTG
GAAGTCAGTGTCACCACATCCAAGATTGTCACAGACAATG
ACACCAAGAGTGAGGAACTGAGATTCCTGAGGCGCCAAGA
GCTACGAGAACTGAGGCTGCTGCAAAAAGAGGAGCAAAGG
GCTCAACAGCAGCTCAGCAATAAACTGCAGCAGCAGAAAG
AGCAACTCTTCAGACGCTTTGAGCAGGAAATGTCGGGAAA
GAAACGGCAGTATGACCAAGAGGTGGAGAACCTTGAGAAA
CAGCAGAAGCAGACTATAGAGCGTCTGGAGCAGGACCACA
CCAACCGACTAAGAGACGAAGCCAAAAGGATCAAAGCTGA
GCAGGACAAGGAGCTCTCCAAGTTCCAGAACATGCTGAAG
AATCGCAAAAAAGAGGAGCAAGAGTTTCTCCAGAGACAGC
AGCAGGAGCTGGATGGAGCTCTGAAGAAGATCATCCAGCA
GCACAAACTGGAGATCGCCACTATAGAAAGAGACTGTCTC
AACCACAAGCAGCAGCTCATGAGAGCAAGAGAAGCAGCCA
TGTGGGAGCTGGAGGAGCGCCACCTGCAGGAGAAACACCA
GTTACTGAAGCAGCAGCTGAAGGATCAATACTTCATGCAG
AGACATCAGCTCCTCAAGAGACATGACAAGGAGATGGAGC
AGATGCAGGGTTATAACCAGCGGTTGATTGAGGAGATGAA
GAACAGACAGGCGCAGGAACGAGCTCGACTGCCGAAGATC
CAGCGCAGTGAAGCCAAGACGCGGATGGCCATGTTTAAGA
AGAGCCTCCGCATCACTGGCACCGGGACGCCAGAGCAGGA
TAGAGAAAAAATCAAACAGTTTGCAGTTCAGGAGGACAAG
AGACAGAAGAATGAGAGACTTCATCAGCATCAAAAACATG
AGAACCAGATGAGAGACCTGCAGCTGCAGTGCGACTCCAA
CATCAGAGAACTTCAGCAGATGCAGAATGAGAAATGTCAC
CTGCTGATTGAGCATGAGACTCAGAAGCTGAAGGAGCTTG
ATGAGGAACACAGTCAGGAGCTAAAAGAATGGAGGGAGAA
GCTTCGGCCACGGAAGAAGGCTCTGGAGGAAGAGTTCACC
CGTAAACTCCAGGAGCAGGAAGTCTTCTTTAAGATGAGCG
GAGAGTCCGAATGTCTCAATCCCAGCACCCAGAGCAGAGT
CTCGAAATTCTACCCTATTCCTAGTGTGCACTCCTCCGGC
TCTTAACCTCCACCACAGAGCAAGAGCTCTTCTAGTCAGG
AGTCTTTTAAAGGTATGAGATCAGAATAGCTGCAGAGGTT
TGAAAAGCTGATTCAAATCTCCCAGTGATGAAGGACAAAC
CTTATGCATTACCTTGACACAGATTTCGCCACATCAAATC
CAATGGATTAACATATTAGTTTTGTTGTCTTCTGGTCATG
TTCATTTGTGCTTGAGATTATAAACACAAATCAACAACGA
ATACACTCAGGCAATATCATCTTGTCTTTGTGGAATATTT
GCGTAAAACAGCCTTAATGAGGGTCAAAGCCCATAACAAA
CATAAGGTCACAGATAGAGGTCACGTTTTAAAGGACAACA
TGACGTTCAATTGTCTTAATGTTTTGCACAGCTACTAAAT
TACGTTTCAGTGCCGTTAGGGTCTTGTATCAGCTGTTATA
TGCCCGTTTTAACGTCCATGCAAAGTTATTTTTAAAACAA
AAATACTCTTTTTAGCTTTTACTATTTGCATTATGGTTGA
AACCATTTGCAGTCAAGGAATGTAACCCGTATGATGACAC
TTTAAAACAATTTGAACATATGCAGTAGTGATCTTATTAG
TGCTTTAGCAAAAAAAAATAGTGCCCAAATATTTGTATGT
GATGTAATTTCTCATTTGGTCAAGTCACTTTGTGGTCCAG
AGTACCGAGTTTATTTTTTATGAGCAGGTTCATTTGAAGC
GGGCGGGCCTTTGCCTTGTTGAATGTTTCATATATGGCGT
TTGAAGATTTATTTATGGATTGAACTGAAGGTTTTAATTG
TTAGTTCTTTTTCTTGTTTCGTCAATATATGAACTCGCAC
GTTACATCGTTTATCCTGATTCATTTTAGTTTTTTATTAT
TACCGAAGAACACGTGCTTTCATAGTCAAATGTAGGGCAG
CATTTGGAACAGTCCACTGCAAAAGTGTTTCCGTGGGAAG
ACCTAAACATTTCTCGCTGTTGCTCTCTGAGGACTTTTCA
TCTGATTCAAGCTCTATTTTTGATAATATGTTTCGTGCAA
GAAGTCACGCATCTGTATCTTAGCCATAATATATGACATG
CTGTGCTCATATACTTTTTGCATGCTGAGATAAATCCCAA
ATGCTGTACTTCACCAGACATAAACTCTTGGAACCGATGA
TGCATTTTACAAAAGGTGGTTTTAAAAGTTGCCGTTGGCA
CAAATAGAGACAGAGAAGTGGCCGATTATCCCAGTGTCAT
ACTGCTGAACAGTGACCTTAACCGCCCGCAGCACTTTGGT
GGAATATCTGATGCATTTTCGAGGTCAATTTATGTATCTA
AATGCTTGTCCATTGATATACTGTAATAATGCTGTAAATA
AAACTCATTGTATTTTCTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations