ZFIN ID: ZDB-TSCRIPT-090929-20885
Transcript Name: slka-204
Previous Names: slka-001, slkn-001, si:ch211-223p8.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040780 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040780|OTTDARG00000029673|ZDB-GENE-050411-66 slka|OTTDARP00000032591 CH211-223P8.7-001 LG_ AL929005.7 Danio rerio protein_coding NOVEL, 4982 bp
ATGTCCTTTTTCAATTTTCGGAAGATATTTAAGTTGGGAA
CGGAGAAGAAGAAGAAACAGTATGAGCATGTCAACAGAGA
CGTCAACCCCGAGGATTTTTGGGAGATCGTGGGAGAGCTT
GGGGATGGAGCCTTTGGCAAAGTCTACAAGGCTCAGAACA
AACAGACTGGGATCTTGGCTGCAGCTAAAGTGATCGATAC
CAAAACAGAAGAGGAGCTTGAGGACTACATGGTGGAGATC
GACATCCTCGCCTCCTGTGACCATCAGTATATAGTCAAAC
TGCTGGATGCTTTCTATTATGAGAGCAAACTCTGGATTCT
CATTGAGTTTTGTGCTGGAGGAGCGGTAGACGCTGTGATG
TTGGAGCTGGAGCGGCCACTGACAGAGCCTCAGATCCGGG
TGGTGTGTAAACAGTCGCTGGAGGCGCTGGTTTACCTCCA
TGAGAATAAGATTATACACCGGGACCTGAAGGCTGGAAAT
ATTCTCTTTACCTCAGATGGAAACATCAAATTGGCTGACT
TTGGAGTGTCTGCAAAGAATACAAAGACCCTACAGAGAAG
AGACTCTTTCATTGGAACGCCATACTGGATGGCACCCGAG
GTGGTGATGTGTGAGACGTCAAAGGACAGACCATACGACT
ACAAAGCGGACATCTGGTCCCTGGGGGTGACGCTGATTGA
GCTGGCACAGATCGAGCCACCCAACCACGAGATGAACCCA
ATGAGAGTCCTGCTAAAAATAGCAAAGTCTGAGCCCCCCA
CTCTGGCATCTCCATCACGATGGTCTCCTGAGTTCAGTGA
TTTCTTGCGGAAAGCACTGGATAAGAATGTAGACAACAGG
TGGAGTGCCTTGCAGCTTTTACAGCATCCATTTGTTTCTA
GTCTAGTGGATAACAAACCACTCCGAGAACTAATTGCTGA
AGCTAAAGCCGAAGTGTTTGAGGAGTTTGAAGAGGGAAAA
GAGGAAGAGGAGGAAGAAGAGCCCGAGCCCCAATCGGCAG
TGCAAGGACACAAACGTGCATTATCAGACACCAGTGTTGG
CAGCTCAGAGGATGAGAGACAAAATCAGAACACGCCAACT
CTCGAGTCGGTCACAGAGAGAGCTGAACCTGAAAGAAAAC
CTGAGGATCGAGCTTGTGACAAGACATCTGCCATGGTGGT
GGATGCTAACGAATCTAACCATCTTGAGGATGGGAAGATA
GTTGAAGCCAATGTTTCAGACACCAGCGCTGAGGAATTAC
GTTCTGGTGATGAGCTCATATCAAAGCAAGAAGAATCTCC
TATGCCAGTTAGCACAGAAGGGGGGGTTACTGATCAGCCG
AATGCTCCAACAGCAAATGACACTAACCTCCAAGAGATTG
TAACTGTCAGTGAGGAAACTGGTGAGGAGGAAAAGAAAGA
AGTGAAGGTGGAAGAGAAACTAGAGAAGAAAGAAGAGGAG
TCTGAAGAAATTAATATGAAAGCCAAAGCACAAAGCATTA
CAGATGAAGAAAAGGAGCATGCCTTACCTTCAGATGAGGC
TGAACCGAAGAATAAATCCGATGGTGTTACTGAAGAAGCC
ATTACTGAACTAATTGAAGTTACAGAAAAAACTGAAGACA
AGCTTGAGAATGAAGAAGAGGTGCATGGAAAGGAACCAGA
AGAAGATAAGACAGTTACCTCAGCTGATGTTCCTACAGAA
AAATTGAAGGAGCAAACAGAAACTTTACCAGATGTTTCTA
CAGAGGAAGTAAAGAAGGAGCAACCGGAAGCTTCACCAGA
TGTTTCTACAGAGGAAGTAAAGGAGCAACCGGAAACTTTA
CCAGGTGCTTCTTCAGAAGAAGTAAAGAAGGAGCAACCGG
AAACTTTACCAGATGCTTCTTCAGAAGAAGTAAAGAAGCA
ACCAGAACCTTCACCGAAAGGTTCTACAGAAGAAGTAAAA
GAGGAGCAACCGGAGACTTCACCAGAAGTTTCTAAAGAAG
TAAAGGAAGATCAGTTGGTCCCAGAGGACCAAAATAAAAC
TGAAGAAAAGGCTGAGATTACAGAACCCAGGGGGGTAGAT
GTGGTAGAGGACATCTCTCTGAGTAAAGTTCCTGTTGTTG
TCATTAATGGTGTGAAAGAAGAGGAGGTCAGTGCTACAGA
AGAACCTGCAGAAGCCCCTGAAGACAGACCAGAGATCCAG
GAAGCCCCTGCCATGCCTGAAAGTGACCACAATACAGTAG
ATGTGGCAAAACCAGATGCCGAAAAGGAAAAAGACTCCGA
TTCAGGCAGCAGTTCTGCTGCAGATACTAATAGCATTGAT
ATTAATCTGTCCATTTCCAGTTTCCTTTCCAAGAGCAAAG
AAGGATCTGTTTCAATACAGGACATCAAACGCCAAAAGAA
AACCCTGAAAAAGACTCGCAAGTTTTTGGTCGACGGGGTG
GAAGTCAGTGTCACCACATCCAAGATTGTCACAGACAATG
ACACCAAGAGTGAGGAACTGAGATTCCTGAGGCGCCAAGA
GCTACGAGAACTGAGGCTGCTGCAAAAAGAGGAGCAAAGG
GCTCAACAGCAGCTCAGCAATAAACTGCAGCAGCAGAAAG
AGCAACTCTTCAGACGCTTTGAGCAGGAAATGTCGGGAAA
GAAACGGCAGTATGACCAAGAGGTGGAGAACCTTGAGAAA
CAGCAGAAGCAGACTATAGAGCGTCTGGAGCAGGACCACA
CCAACCGACTAAGAGACGAAGCCAAAAGGATCAAAGCTGA
GCAGGACAAGGAGCTCTCCAAGTTCCAGAACATGCTGAAG
AATCGCAAAAAAGAGGAGCAAGAGTTTCTCCAGAGACAGC
AGCAGGAGCTGGATGGAGCTCTGAAGAAGATCATCCAGCA
GCACAAACTGGAGATCGCCACTATAGAAAGAGACTGTCTC
AACCACAAGCAGCAGCTCATGAGAGCAAGAGAAGCAGCCA
TGTGGGAGCTGGAGGAGCGCCACCTGCAGGAGAAACACCA
GTTACTGAAGCAGCAGCTGAAGGATCAATACTTCATGCAG
AGACATCAGCTCCTCAAGAGACATGACAAGGAGATGGAGC
AGATGCAGGGTTATAACCAGCGGTTGATTGAGGAGATGAA
GAACAGACAGGCGCAGGAACGAGCTCGACTGCCGAAGATC
CAGCGCAGTGAAGCCAAGACGCGGATGGCCATGTTTAAGA
AGAGCCTCCGCATCACTGGCACCGGGACGCCAGAGCAGGA
TAGAGAAAAAATCAAACAGTTTGCAGTTCAGGAGGACAAG
AGACAGAAGAATGAGAGACTTCATCAGCATCAAAAACATG
AGAACCAGATGAGAGACCTGCAGCTGCAGTGCGACTCCAA
CATCAGAGAACTTCAGCAGATGCAGAATGAGAAATGTCAC
CTGCTGATTGAGCATGAGACTCAGAAGCTGAAGGAGCTTG
ATGAGGAACACAGTCAGGAGCTAAAAGAATGGAGGGAGAA
GCTTCGGCCACGGAAGAAGGCTCTGGAGGAAGAGTTCACC
CGTAAACTCCAGGAGCAGGAAGTCTTCTTTAAGATGAGCG
GAGAGTCCGAATGTCTCAATCCCAGCACCCAGAGCAGAGT
CTCGAAATTCTACCCTATTCCTAGTGTGCACTCCTCCGGC
TCTTAACCTCCACCACAGAGCAAGAGCTCTTCTAGTCAGG
AGTCTTTTAAAGGTATGAGATCAGAATAGCTGCAGAGGTT
TGAAAAGCTGATTCAAATCTCCCAGTGATGAAGGACAAAC
CTTATGCATTACCTTGACACAGATTTCGCCACATCAAATC
CAATGGATTAACATATTAGTTTTGTTGTCTTCTGGTCATG
TTCATTTGTGCTTGAGATTATAAACACAAATCAACAACGA
ATACACTCAGGCAATATCATCTTGTCTTTGTGGAATATTT
GCGTAAAACAGCCTTAATGAGGGTCAAAGCCCATAACAAA
CATAAGGTCACAGATAGAGGTCACGTTTTAAAGGACAACA
TGACGTTCAATTGTCTTAATGTTTTGCACAGCTACTAAAT
TACGTTTCAGTGCCGTTAGGGTCTTGTATCAGCTGTTATA
TGCCCGTTTTAACGTCCATGCAAAGTTATTTTTAAAACAA
AAATACTCTTTTTAGCTTTTACTATTTGCATTATGGTTGA
AACCATTTGCAGTCAAGGAATGTAACCCGTATGATGACAC
TTTAAAACAATTTGAACATATGCAGTAGTGATCTTATTAG
TGCTTTAGCAAAAAAAAATAGTGCCCAAATATTTGTATGT
GATGTAATTTCTCATTTGGTCAAGTCACTTTGTGGTCCAG
AGTACCGAGTTTATTTTTTATGAGCAGGTTCATTTGAAGC
GGGCGGGCCTTTGCCTTGTTGAATGTTTCATATATGGCGT
TTGAAGATTTATTTATGGATTGAACTGAAGGTTTTAATTG
TTAGTTCTTTTTCTTGTTTCGTCAATATATGAACTCGCAC
GTTACATCGTTTATCCTGATTCATTTTAGTTTTTTATTAT
TACCGAAGAACACGTGCTTTCATAGTCAAATGTAGGGCAG
CATTTGGAACAGTCCACTGCAAAAGTGTTTCCGTGGGAAG
ACCTAAACATTTCTCGCTGTTGCTCTCTGAGGACTTTTCA
TCTGATTCAAGCTCTATTTTTGATAATATGTTTCGTGCAA
GAAGTCACGCATCTGTATCTTAGCCATAATATATGACATG
CTGTGCTCATATACTTTTTGCATGCTGAGATAAATCCCAA
ATGCTGTACTTCACCAGACATAAACTCTTGGAACCGATGA
TGCATTTTACAAAAGGTGGTTTTAAAAGTTGCCGTTGGCA
CAAATAGAGACAGAGAAGTGGCCGATTATCCCAGTGTCAT
ACTGCTGAACAGTGACCTTAACCGCCCGCAGCACTTTGGT
GGAATATCTGATGCATTTTCGAGGTCAATTTATGTATCTA
AATGCTTGTCCATTGATATACTGTAATAATGCTGTAAATA
AAACTCATTGTATTTTCTTTGA

slka TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slka-203 (1)    Ensembl 362
slka-204 4982
ncRNA slka-003 (1)    Ensembl 556
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slka-204 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000040780 (1),  Ensembl_Trans:ENSDART00000142745 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT699788 (1) 814 nt
GenBank:CD759158 (1) 789 nt
GenBank:BF156388 (1) 765 nt
GenBank:DN897935 (1) 727 nt
GenBank:EB941427 (1) 665 nt
GenBank:AW777919 (1) 395 nt
CITATIONS (2)