header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19869
Transcript Name: slc33a1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039605 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039605|OTTDARG00000028928|ZDB-GENE-040426-1241 slc33a1|OTTDARP00000031670 slc33a1-002 LG_ CU570794.4 Danio rerio protein_coding KNOWN, 466 bp
GCAGTCAGGTGTATTTACTGCGCTTCCTTGCGCCTTGTAA
ACATTAGGTATATTACATATCTGTGTGGATATTTTTTGTC
TCAGCAAAGTGCTGCTCATTTGCCGTCAGTGAGTTTTTTC
GTCATTCATGTAAAGCTTTTACTCATTGATTCACTGATGT
CTTGATTTGTCATGTGGTTTGTCATCATAGTGCAAGGTGT
TTTGAGGCCATATCTGGATTGATGCCCGGCAGATTAAGAT
GGAACTGTCTGAATCTCTCACACACAAGAACGGGAGGCAG
CGGAAGCCTGTGCTGCTCAACATGGGGGAAAGAGAGTCCA
AGCTAGAAGTTGGGGGAGATGAAGAGGCTCTTCTTCCAAA
CTCTGACAGAGCCGATGGACGAACGCAAACACACAAAGGG
ATTAAAGGAGAACTGGGCAATGTGTCCCTGTTATTGTTCC
TGTATGTGCTTCAGGGCATTCCTTTA

slc33a1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA slc33a1-002 466
slc33a1-201 (1) 1834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc33a1-002 Contained in:
OTHER slc33a1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039605 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB915971 (1) 466bp
    CITATIONS (1)