header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19868
Transcript Name: slc33a1-201
Previous Name: slc33a1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039604 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039604|OTTDARG00000028928|ZDB-GENE-040426-1241 slc33a1|OTTDARP00000031669 slc33a1-001 LG_ CU570794.4 Danio rerio protein_coding KNOWN, 1834 bp
TCATTCTAGCAGTCAGGTGTATTTACTGCGCTTCCTTGCG
CCTTGTAAACATTAGGTATATTACATATCTGTGTGGATAT
TTTTTGTCTCAGCAAAGTGCTGCTCATTTGCCGTCAGTGT
TTTGAGGCCATATCTGGATTGATGCCCGGCAGATTAAGAT
GGAACTGTCTGAATCTCTCACACACAAGAACGGGAGGCAG
CGGAAGCCTGTGCTGCTCAACATGGGGGAAAGAGAGTCCA
AGCTAGAAGTTGGGGGAGATGAAGAGGCTCTTCTTCCAAA
CTCTGACAGAGCCGATGGACGAACGCAAACACACAAAGGG
ATTAAAGGAGAACTGGGCAATGTGTCCCTGTTATTGTTCC
TGTATGTGCTTCAGGGCATTCCTTTAGGCTTGGCTGGCAG
CATTCCTCTCATCATGCAGAGTAAGAATGTCAGCTATAAA
GACCAGGCCTATTTCAGCTTCGTCTTTTGGCCCTTCAGTC
TAAAGTTGTTCTGGGCTCCTCTGGTGGACTCTGTGTATCT
CAAGCAGTTTGGCAGGAGGAAGTCCTGGCTGGTTCCTACT
CAGTACCTGCTTGGTCTTTTTATGCTGTATCTGTCATTGA
CCGTTGACTCCATGCTTCAGACGGATGGACAGAAGGGGCC
GGATGTGATTACTTTAACCGCAGTCTTCTTCTTGCTGGCT
TTCCTCGCAGCCACGCAGGACATTGCCGTTGATGGCTGGG
CTTTGACTATGCTGTCCAGGGAAAATGTGGGTTATGCTTC
CACTTGTAACTCTGTGGGTCAGACGGCAGGATACTTCCTG
GGAAATGTGCTGTTTCTGGCTCTGGAGTCGGCTGATTTCT
GCAACAAGTATTTGAGGTTTGAGCCTCAGGAACGGGGAAT
TGTTACACTCTCAGATTTCTTGTTTTTCTGGGGGATTGTG
TTTATGGTGTCCACCACTCTGGTCGCTGTCCTGAAGAAGG
AAAATGGCAAACCCCATCCCGCTAAGAAGAAGCCCAAAGA
GGAGACACAGGGTGTGAAGGAGACTTACAAACTTCTGTTT
TCCATCATTAAAATGCCCACCGTCTTTACTTTCTGTGCCC
TACTACTGACTGCTAAGGTGGGATTCTCCGCTGCAGATGC
CGTGACGGGGCTGAAGTTAGTGGAAGCTGGAGTTCCAAAA
GAGCAGCTAGCTCTGCTGGCAGTCCCAATGGTGCCTCTGC
AGATCCTGCTGCCTCTGGTTATTAGTAAATACACAGCTGG
CCCACGTCCACTCGACATTTTCTACAAGGCATTTCCGTTT
AGGTTACTGATTGGTCTAGAATATGCCCTGCTGGTTTGGT
GGACCCCAAGTGTTCGGCAGGAGGAGGGCTTTCCTGTCTA
TTACTATGCTGTTGTGCTTCTGAGCTATGCAGTACATCAG
GTGGCACTATACAGCATGTATGTTGCCTGCATGGCCTTTC
ATGCCAAGGTCAGTGACCCTGTGATTGGGGGCACCTACAT
GACCCTTCTGAACACTGTGACTAATCTAGGAGGGAATTGG
CCCTCAACACTGGCTCTATGGCTGGTGGACCCACTCACCT
CAAAAGAGTGTGACGGGGCCCCTGGACAGACGTGCAGCTC
CATTGAAGAAGCAGGACTCTGTGTCAGAGAAGGTGGTTCG
TGTGTCACATCATTGGACGGTTACTATGTGGAGTCTGTGG
TGTGCGTTCTGATTGGCCTCTGCTGGTGGATCTTCTTTGG
GAAAAGAATGAAGCGCTTACAAGAAGAAAGTCCCTCTGCG
TGGCATTGCAGGGTTGCTAAATAGCAATCTCGAATGAACT
CTTCCTCTTGTTTTAAAGCTACTTCATGCCTCTC

slc33a1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA slc33a1-002 (1) 466
slc33a1-201 1834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc33a1-201 Contained in:
OTHER slc33a1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039604 (1)
  • Ensembl_Trans:ENSDART00000015079 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055208 (1) 1873bp
    CITATIONS (2)