ZFIN ID: ZDB-TSCRIPT-090929-19263
Transcript Name: pax1a-202
Previous Names: pax1a-002, zgc:158781-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038936 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038936|OTTDARG00000028540|ZDB-GENE-070112-182 pax1a|OTTDARP00000031159 pax1a-002 LG_ BX927409.14 Danio rerio protein_coding KNOWN, 976 bp
TTAGACTGACGTGGATGACGCGTCAAATTAACTCCAGCAA
ACATCACCCTGCGGGATCAGACAAATCCCTCTTTAACGGG
AGAGGATCACTCTTGTCCCATTCTACCATAGAGAAGTTTG
GCATGTAGAAGTTTTGCTACCGGGCAGAAAAAAAAGTTGC
AAAAGTCTTCGGAACATCTCTACACAGTTATACTGCGGAC
TGCATTGTTCAGCCATTGAAGGGACACTTTAACATAGACG
CATCGCAAAAGCAAATGGAGCAAACATACGGGGAGGTGAA
CCAGCTGGGGGGAGTTTTTGTCAATGGACGCCCTTTGCCC
AACGCAATAAGATTACGAATAGTGGAGTTAGCCCAGCTTG
GCATCCGACCATGTGACATAAGCAGACAGCTTCGGGTCTC
TCATGGTTGTGTGAGTAAAATCCTTGCGAGATACAACGAA
ACAGGGTCCATTTTGCCCGGTGCCATCGGTGGCAGCAAAC
CACGAGTTACGACGCCAAATGTAGTGAAAAACATACGGGA
CTACAAACAAAGTGACCCGGGAATTTTTGCATGGGAGATC
CGGGACCGTCTCCTCGCGGACGGAGTATGTGATAAGTACA
ACGTGCCTTCGGTCAGCTCTATCAGCCGGATATTAAGGAA
CAAGATTGGAAACCTCTCCCAACCTAACCCATATGAAAAT
GGCAAGCAAGCACCACCGCAGTCCAGCCTTTCCTATAACC
ACATATACCCGTATTCATACCCCAATGCAATGTCTCCTTC
CGGGACAAAAATGAGCAGTCCTCCTGGTGTCCCTGTAACG
GGTGGGCATGTAAGCATTTCCCGTGGTTGGCCTTCAGCCC
ATACGGTCAGCAATATATTGGGCATTCGGGCTTTCATGGA
TCCTACAGCTATTGCTAGCGCTGAAGGATACGCACCGAAA
ATGGAGGATTGGGGTGTCAATAGAGCGACATTTCAAAGTC
ATGGAGTCAATGGAAT

pax1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pax1a-201 (1)    Ensembl 1597
pax1a-202 976
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax1a-202 Contained in:
[BAC] DKEY-89L19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038936 (1),  Ensembl_Trans:ENSDART00000134377 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH580970 (1) 926 nt
GenBank:EB767146 (1) 663 nt
GenBank:EB905683 (1) 461 nt
CITATIONS (2)