ZFIN ID: ZDB-TSCRIPT-090929-19262
Transcript Name: pax1a-201
Previous Names: pax1a-001, zgc:158781-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038935 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038935|OTTDARG00000028540|ZDB-GENE-070112-182 pax1a|OTTDARP00000031158 pax1a-001 LG_ BX927409.14 Danio rerio protein_coding KNOWN, 1597 bp
TTGATTTAGGTCATGTGTGTTATATGTGCCATGCTGTTTT
ACGACATTTATTTTCCATTGCCTAAGTTGAATGCTTTCGT
GTCTTGCAGAGCAAACATACGGGGAGGTGAACCAGCTGGG
GGGAGTTTTTGTCAATGGACGCCCTTTGCCCAACGCAATA
AGATTACGAATAGTGGAGTTAGCCCAGCTTGGCATCCGAC
CATGTGACATAAGCAGACAGCTTCGGGTCTCTCATGGTTG
TGTGAGTAAAATCCTTGCGAGATACAACGAAACAGGGTCC
ATTTTGCCCGGTGCCATCGGTGGCAGCAAACCACGAGTTA
CGACGCCAAATGTAGTGAAAAACATACGGGACTACAAACA
AAGTGACCCGGGAATTTTTGCATGGGAGATCCGGGACCGT
CTCCTCGCGGACGGAGTATGTGATAAGTACAACGTGCCTT
CGGTCAGCTCTATCAGCCGGATATTAAGGAACAAGATTGG
AAACCTCTCCCAACCTAACCCATATGAAAATGGCAAGCAA
GCACCACCGCAGTCCAGCCTTTCCTATAACCACATATACC
CGTATTCATACCCCAATGCAATGTCTCCTTCCGGGACAAA
AATGAGCAGTCCTCCTGGTGTCCCTGTAACGGGTGGGCAT
GTAAGCATTTCCCGTGGTTGGCCTTCAGCCCATACGGTCA
GCAATATATTGGGCATTCGGGCTTTCATGGATCCTACAGC
TATTGCTAGCGCTGAAGGATACGCACCGAAAATGGAGGAT
TGGGGTGTCAATAGAGCGACATTTCAAAGTCATGGAGTCA
ATGGAATAGACAAATCATCCATTGATGCAGACATAAAATA
CCCTCAGCCTTCGTCGACCCTGTCTAGCTATGTCCCGGCG
TGCGCGTACTCTCCCTCCAACCAATACGGCGTGTACAGTG
GTCCAGCAGGCGGTTATGTGAGTCCAGGTCACCATTGGCA
GGCCCAGGGCACTAGTCTTACCCACCCTGGCGGTGGCGTA
GCGATGCACCCGAGTGACATCCATTCTTCTATGGCGTTCA
AACATGCAGTACGAGATGGAGACAGAAAACCACCGAGTCC
CCTTAGCAAGCAGCAGCACGAAGCCTTGTCTGGTATACAC
GGACTCAGCCTTTCTACCTCATCCTCGTAACAGCACTGAC
ACGTCCGTTATAGACATTATCCCATTTCAACAAAGCAAAC
CGTAAGTTAAAGCAATTCACATCATTGGACTGTGTTAGAG
CCCGTGTTCAACGCTCTCTGGGAATTCTGGGTTAAATTGA
ATGAATGTATATGACTTACTGTAACTATAACTGTCTCCAG
GCTGCGTTGTTTGGTGGTTGGCTATTTAAACATTGTGTCA
TGCTGGTTTTGTCTATGTTATTTATGACAGTGACTGCATG
CAAAGTGAGATTCGTCACTTTAAAGCTAAATTACGCATTT
TAAAGAAAATGAAAAGGCATTTCATGGACTTGTAGATTAA
ATAAACCTTATGTGAACAAAGTAATAAATTGTTAATGTAA
ATACGGATAAAGCTTTAGTTATATATTTTTATAAATCCAT
GTGTAAATATGCTAAATAAAGGTATTGTATAAAAAGA

pax1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pax1a-201 1597
pax1a-202 (1)    Ensembl 976
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax1a-201 Contained in:
[BAC] DKEY-89L19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038935 (1),  Ensembl_Trans:ENSDART00000020156 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC129448 (1) 1632 nt
CITATIONS (2)