ZFIN ID: ZDB-TSCRIPT-090929-19155
Transcript Name: fanci-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038805 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038805|OTTDARG00000028480|ZDB-GENE-030131-2905 fanci|no_translation fanci-002 LG_ CR854881.13 Danio rerio protein_coding KNOWN, 3400 bp
CAAGCGACAGTCTAAAAGAAGATTTTAAAGCCAATTCTTC
GTAAAAACACTAACCAGGTCTGTGTACATACAGTACAGTA
GATGTCCAAGATGAAGGTTACAGTGGATTCGATATTATCA
TTATCTGAGACTGATGATGGAGATGAGCTGCAGAAGCATC
TCACTTTGTTGTCTGATGATCAGCTCACAACCATGCTTAC
TAATAGTGCTCTTAAAGGGAAGGATACAGGAATCCTGATC
AAAGCCATATTTAAAGGTTCACCAGTAAGTGTCTCTCATG
GTGCAAACCGTAGACTGCTTGTGTATAAGCACTGTATTCC
ACTGTGTGAGTCTGGAGACCTGCAGACAGAAGTGGCCTCG
GACATCATCGGCCTTCTGATGCTGGACACACACAGTCTTC
CTGGACCTGCATTAGCCACTTTAGCGTCTCTATACGTGGA
TGCTATCAAAGTGGGTGAGATGAACAGTGGGAGATCACTG
GAACTCTTCCCTACAATCTTAACAGCTCTTTCTGCTACAG
ATGCATTGGCCTATGGGAAAGGTGAGCTGACTGGAAATGA
GTACAAGAAACAGCTGATCAACAGTCTTTGCTCTAGCAGA
TGGGATCCGCAGTGTGTAATTCACCTTACAACCATGTTCA
GGGATGTTCCCTTATCAACGGAGGAGCTTCAGTTTCTGAT
TGAGAAGATTCTGCGCATGTTCCTGAAGCTTGATCTACAA
GAGATTCCTCCTCTGGTCTATCAGCTGCTGCTACTGTCTG
CTAAGGGCTGTAAGAAGTTGGTTCTGGAGGGAATCATTAA
TTACTTCAAAAAGCAAGACCAGCTTCAGAAAGAGGAGCAG
AGAAATGGAGAGTGTGAAGATGTGGAGGTGCAGACCATCC
CACAGGATCAGCTACGGCATGTAGAAGGAACTGTGATCCT
ACACATCGTTTTTGCCATTCGTCTCGACCATGAGCTCGGG
AGGGAGTTTTTTAAAAACCTTAAGGTGGCCCAGAGTGATC
CGCTGTGTCCGTTCAGTATCGCTCTGCTGCTCTCAGTGGC
TCGCATACAACGATACGAGGAGCAGGTATTTGAGTTCCTG
AAGGGCGCCATCACTAAAAACTTCAAGGATGATCAGATTC
AGAACAGCTCAAAGTTTCTGCAGGATCTCCTGCCGCAGTT
TAGCAGCGTCTCTGACATGATTCTGGACACTGTCAAAAAC
AGTGTGTTCGGCTGGGATCATGTCACTCAGGGTCTGGTGC
AACTTGGATTTATCCTGATGGACTCATTCGGCCCTAAACC
AGGACCATTCGGAAAGGTGACAGAAGGAACGTCAAGTACG
GCTAAAACACCAAACCAGCTAGCATGTAGACTTGGTGGAC
AAGTTCTCCTGGAGAGCTTTAAGATGCATGAACCAATCAG
AGGCGAGATACTTGAACAAGTCTTGAACCGATTGGTTACT
AAAACAGCCTCTCCTGTCACCCATTTCATTGACCTTCTTT
CCAGCATAGTGTTGTCTGCTCCCATGATCCTCTTGGAATC
TTCCTCTAAGGTCACAGAAACATTTGACCAGCTCTCTTAT
TTGCCTCTTAGTACAGTACAGGGGCTCCTCAAAGCGGTGC
AGCCCCTGCTTAAAGTGAGCATGTCTATGAAAGATGCCCT
CATTCTGGTCCTCCGGAAGGCCATGTTCTCCAGTCATTTA
GATGGCAGAAAGTCAGCAGTGGCGGGATTTCTGCTGCTGC
TGAAGAACTTTCGTATTCTGGGGAGTTTAGCTTCTAGCCA
GGCTAGTCAGGCCATTACATCAAGCCAGGTCCAGGCGGAC
GTTCACTCACGCTACAACACAGCCGCTAATGAAGCCTTCT
GTCTGGAGATCCTGAGCAGTTTACGCCGCTGCCTCAACCA
GCAGGCTGACGTCCGGCTCATGCTTTATGAGGGTTTCCAC
GATGTCCTCCGTCGTAACTCTCAGCTGGCGAGTTCCATCA
CTCAGACTCTCCTGTCACAACTGAAGCGATACTTTGAGCC
CGAACAAGATCTTCTGCCTCCTGTGAAGCTGGAGTCGTGT
ATCAGCGCTCAGGGAGATCAGGTCTTCCTCCAGGAGCCTC
TGGCTCATCTGCTGTGCTGTACGGTTCACTGTCTGCTGTG
GAACCAGAACGTGAGGTCTGGTGGTAATGTGAGCGATGAC
GAGGATGATGAAGAAGATGTGGGTGGAGTGGAGAGTGAAC
TGCAGGCCATGCTGGAGAGCATAACGAAGCGCATGATTAA
GAGCGAACTGGAGGATTTTGAGTTGGATAAGTGTGCTGAG
TTTTCGACGGGTTCCAGTGTTGGAGTGAAGAACAGCATCT
ACGCTGTACTGGTGATGGGACTGAACGAGGTTCTGATGGA
GTACAACTTCATCACTGCCAATTACAGTAAAAACCACTTT
GAGGACGTTCTGGAGCTCTTCAAGCGTTATCTTAAGGTGT
GTGATATCCTGAGAGAGCGGGCTGGGAAGGGTCGTCCCGC
ATCCAGCAAAACCCCTCGCAGTCTCCTGTCACTGGGCTTT
GTGTCTACACTGCTCACGGCTCTCTTCAGGGACAGCACTC
AGAGTCGTGAGGAGAGTCTGTCGGTGTTGCGCTCCAATGG
AGATTTCCTGCGTTACAGTGTGAGCGTCGCCCTGCAGAAG
ATCCAGCAGTTAGAGGAGACGGGACACACTGACGGCCCCG
AGGGGCAGAGTCCTGACAAGACCTTCCGCCATCTCTGTGA
CATCACCAGTGTGCTAATGTGGCGCTATACCAATGTGCCG
TCCACTGTGGAGGATGCTGGAAAGAAGGAGAAGGGTCAGA
GCGTCTCTTTACTATGTCTAGAGGGTTTACTGCGAGTCTT
CACTACGGTACTACAGCGATACCCCACACGAGTCAGCTGG
GAGACATCGACCAGGACGTCGAGGTGGAGAAACAGTCTCA
TTTCGCCATCATCTGCATGAAAACGGCTGCGTCCACCACG
CTTCAGGTCTTGTCTCAGGTTGGGAAGGTGTTGGATGAAG
TGGACTGGTTGATCGCCAAGAAGAAAGCCCAGATAAGCTC
AGACAGAACTATTTCAGGAAATACCCAGCAGCCACTGGGC
CAGCAGGACCCGATTGAGAAAGCGATCACCATCCAGTTAG
GCACACTGTTAACGGCTCTGCATGAGCTGGTTCAGACGGC
TCTGCCCACAGGAGCCTGTACAGACACACTGATGAGAGAG
CTCAGTCGAACATACTGCATCCTGACCACACTTACCAAAT
ACTATATTCAGCTGTGCGCGACTCAACCTGGACAACTTCC
TGCACGTTTGGAGAAACTGGTGAAGCTGTCAGGATCTCAC
CTCACGCCTCAATGTTACTGCTTCATCACCTACGTGCAGA
GTGGAGAGCTGACGGCAGGAGGATCAGAGAAACTGAAGAA

fanci TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fanci-002 3400
mRNA fanci-202 (1) 4488
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fanci-002 Contained in:
OTHER fanci-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038805 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124608 (1) 3417bp
    CITATIONS (1)