ZFIN ID: ZDB-TSCRIPT-090929-19154
Transcript Name: fanci-202
Previous Name: fanci-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038804 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038804|OTTDARG00000028480|ZDB-GENE-030131-2905 fanci|OTTDARP00000031080 fanci-001 LG_ CR854881.13 Danio rerio protein_coding KNOWN, 4488 bp
GGCGGGAGTTTCAGTTGTTATTAAACAAGCTAACAGCGCA
CCTACAGCGAAAGCAAGCGACAGTCTAAAAGAAGATTTTA
AAGCCAATTCTTCGTAAAAACACTAACCAGGTCTGTGTAC
ATACAGTACAGTAGATGTCCAAGATGAAGGTTACAGTGGA
TTCGATATTATCATTATCTGAGACTGATGATGGAGATGAG
CTGCAGAAGCATCTCACTTTGTTGTCTGATGATCAGCTCA
CAACCATGCTTACTAATAGTGCTCTTAAAGGGAAGGATAC
AGGAATCCTGATCAAAGCCATATTTAAAGGTTCACCAGTA
AGTGTCTCTCATGGTGCAAACCGTAGACTGCTTGTGTATA
AGCACTGTATTCCACTGTGTGAGTCTGGAGACCTGCAGAC
AGAAGTGGCCTCGGACATCATCGGCCTTCTGATGCTGGAC
ACACACAGTCTTCCTGGACCTGCATTAGCCACTTTAGCGT
CTCTATACGTGGATGCTATCAAAGTGGGTGAGATGAACAG
TGGGAGATCACTGGAACTCTTCCCTACAATCTTAACAGCT
CTTTCTGCTACAGATGCATTGGCCTATGGGAAAGGTGAGC
TGACTGGAAATGAGTACAAGAAACAGCTGATCAACAGTCT
TTGCTCTAGCAGATGGGATCCGCAGTGTGTAATTCACCTT
ACAACCATGTTCAGGGATGTTCCCTTATCAACGGAGGAGC
TTCAGTTTCTGATTGAGAAGATTCTGCGCATGTTCCTGAA
GCTTGATCTACAAGAGATTCCTCCTCTGGTCTATCAGCTG
CTGCTACTGTCTGCTAAGGGCTGTAAGAAGTTGGTTCTGG
AGGGAATCATTAATTACTTCAAAAAGCAAGACCAGCTTCA
GAAAGAGGAGCAGAGAAATGGAGAGTGTGAAGATGTGGAG
GTGCAGACCATCCCACAGGATCAGCTACGGCATGTAGAAG
GAACTGTGATCCTACACATCGTTTTTGCCATTCGTCTCGA
CCATGAGCTCGGGAGGGAGTTTTTTAAAAACCTTAAGGTG
GCCCAGAGTGATCCGCTGTGTCCGTTCAGTATCGCTCTGC
TGCTCTCAGTGGCTCGCATACAACGATACGAGGAGCAGGT
ATTTGAGTTCCTGAAGGGCGCCATCACTAAAAACTTCAAG
GATGATCAGATTCAGAACAGCTCAAAGTTTCTGCAGGATC
TCCTGCCGCAGTTTAGCAGCGTCTCTGACATGATTCTGGA
CACTGTCAAAAACAGTGTGTTCGGCTGGGATCATGTCACT
CAGGGTCTGGTGCAACTTGGATTTATCCTGATGGACTCAT
TCGGCCCTAAACCAGGACCATTCGGAAAGGTGACAGAAGG
AACGTCAAGTACGGCTAAAACACCAAACCAGCTAGCATGT
AGACTTGGTGGACAAGTTCTCCTGGAGAGCTTTAAGATGC
ATGAACCAATCAGAGGCGAGATACTTGAACAAGTCTTGAA
CCGATTGGTTACTAAAACAGCCTCTCCTGTCACCCATTTC
ATTGACCTTCTTTCCAGCATAGTGTTGTCTGCTCCCATGA
TCCTCTTGGAATCTTCCTCTAAGGTCACAGAAACATTTGA
CCAGCTCTCTTATTTGCCTCTTAGTACAGTACAGGGGCTC
CTCAAAGCGGTGCAGCCCCTGCTTAAAGTGAGCATGTCTA
TGAAAGATGCCCTCATTCTGGTCCTCCGGAAGGCCATGTT
CTCCAGTCATTTAGATGGCAGAAAGTCAGCAGTGGCGGGA
TTTCTGCTGCTGCTGAAGAACTTTCGTATTCTGGGGAGTT
TAGCTTCTAGCCAGGCTAGTCAGGCCATTACATCAAGCCA
GGTCCAGGCGGACGTTCACTCACGCTACAACACAGCCGCT
AATGAAGCCTTCTGTCTGGAGATCCTGAGCAGTTTACGCC
GCTGCCTCAACCAGCAGGCTGACGTCCGGCTCATGCTTTA
TGAGGGTTTCCACGATGTCCTCCGTCGTAACTCTCAGCTG
GCGAGTTCCATCACTCAGACTCTCCTGTCACAACTGAAGC
GATACTTTGAGCCCGAACAAGATCTTCTGCCTCCTGTGAA
GCTGGAGTCGTGTATCAGCGCTCAGGGAGATCAGGTCTTC
CTCCAGGAGCCTCTGGCTCATCTGCTGTGCTGTACGGTTC
ACTGTCTGCTGTGGAACCAGAACGTGAGGTCTGGTGGTAA
TGTGAGCGATGACGAGGATGATGAAGAAGATGTGGGTGGA
GTGGAGAGTGAACTGCAGGCCATGCTGGAGAGCATAACGA
AGCGCATGATTAAGAGCGAACTGGAGGATTTTGAGTTGGA
TAAGTGTGCTGAGTTTTCGACGGGTTCCAGTGTTGGAGTG
AAGAACAGCATCTACGCTGTACTGGTGATGGGACTGAACG
AGGTTCTGATGGAGTACAACTTCATCACTGCCAATTACAG
TAAAAACCACTTTGAGGACGTTCTGGAGCTCTTCAAGCGT
TATCTTAAGGTGTGTGATATCCTGAGAGAGCGGGCTGGGA
AGGGTCGTCCCGCATCCAGCAAAACCCCTCGCAGTCTCCT
GTCACTGGGCTTTGTGTCTACACTGCTCACGGCTCTCTTC
AGGGACAGCACTCAGAGTCGTGAGGAGAGTCTGTCGGTGT
TGCGCTCCAATGGAGATTTCCTGCGTTACAGTGTGAGCGT
CGCCCTGCAGAAGATCCAGCAGTTAGAGGAGACGGGACAC
ACTGACGGCCCCGAGGGGCAGAGTCCTGACAAGACCTTCC
GCCATCTCTGTGACATCACCAGTGTGCTAATGTGGCGCTA
TACCAATGTGCCGTCCACTGTGGAGGATGCTGGAAAGAAG
GAGAAGGGTCAGAGCGTCTCTTTACTATGTCTAGAGGGTT
TACTGCGAGTCTTCACTACGGTACTACAGCGATACCCCAC
ACGAGTCAGCAACTTCCTGTCTTCTCTAGATGTTTCAGGG
GAAGGAGAGGGCGACAAATCTGATCTGACGGAGCAAACGG
CTTTCTATATCCGCCAGTTTCAGCGAGCACTGATGAACCA
GCTCAGCGGGCCAGAAGAAGAGTTCAACAGTAAAGAAGCT
CAGTTACTGGTCAGCATCCTCAGCGTTTTGTCACGACAGC
TCAGTCCGTCCTCTCAGCAGTTTTTGCAAATGATCACCTG
GACTGTGAAAATTTGTAAGGAAACCAACTTTGAGGACATC
GCTCTCACTAAAGGCTTGCTGTCTCTGCTGTTCAGCCTGT
ATGTCCTGCATAAGAGCCCAGTGTCTCTGCTGTGGGAGAT
GTGCCAGGACATACACAGCCAGCTGGGAGACATCGACCAG
GACGTCGAGGTGGAGAAACAGTCTCATTTCGCCATCATCT
GCATGAAAACGGCTGCGTCCACCACGCTTCAGGTCTTGTC
TCAGGTTGGGAAGGTGTTGGATGAAGTGGACTGGTTGATC
GCCAAGAAGAAAGCCCAGATAAGCTCAGACAGAACTATTT
CAGGAAATACCCAGCAGCCACTGGGCCAGCAGGACCCGAT
TGAGAAAGCGATCACCATCCAGTTAGGCACACTGTTAACG
GCTCTGCATGAGCTGGTTCAGACGGCTCTGCCCACAGGAG
CCTGTACAGACACACTGATGAGAGAGCTCAGTCGAACATA
CTGCATCCTGACCACACTTACCAAATACTATATTCAGCTG
TGCGCGACTCAACCTGGACAACTTCCTGCACGTTTGGAGA
AACTGGTGAAGCTGTCAGGATCTCACCTCACGCCTCAATG
TTACTGCTTCATCACCTACGTGCAGAGTGGAGAGCTGACG
GCAGGAGGATCAGAGAAACTGAAGAAGAAGAAAAAAGAAG
AGGAAGCTGTAGCGGCGGCTTCAGCTAAAGTTCTGCGTGA
GACTAAAGCCATCCCAAACCTGATTTTCAACATCGAACAG
TACGAGAAGTTTCTTATTCTCCTGTCCAAGAAGTCCAAGG
TCAATCTGATGCAGTACATGAAGCTGAGCACTTCCAGAGA
CTTCCGGATCAACGCGGCCACACTGGAGGCTGCGTTACAG
GAGCAGGAGCAGGACCAAAGCCAGCAGAGTGAAGATGCTC
AGAGTCAAGCACCAAAGAAAAAAAGGAGGAAGAAGTGAGA
GGAGAAGCCTTCAGTCATTGTTTTGCACTTTCCCTCCATC
CTATTTGTTCATTTCTGGGTGAGATTGCACTGAGAGCCGC
TCATCCCACAGATGTTATTTTGACCTTGGAGCTTGTCGTT
TTTCTTTGGTCAGCGAGCCCTTGGTGATCTCTATAATCTG
ATAAATGTCCAGCGCCTCGCCTGTGGATTATAAAAACACC
ATCAGCTTTGTTCACAGTATCACACTGATGACGTATAAAG
ACTGAACGCTTCATTTAGCTCTTAATATTGTAATCTTTTA
GACTCGTTCTTAATGTTCACTGAATGCTGCTATTCTCTCT
TAATAAACAAATACCCAAATGTCATCTGGTGCATTTCCTG
AAAAATCC

fanci TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fanci-002 (1) 3400
mRNA fanci-202 4488
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fanci-202 Contained in:
OTHER fanci-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038804 (1)
  • Ensembl_Trans:ENSDART00000142090 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EG569000 (1) 941bp
    GenBank:EG569806 (1) 868bp
    GenBank:EE713400 (1) 852bp
    GenBank:CN502761 (1) 749bp
    GenBank:EB930145 (1) 701bp
    GenBank:EB929584 (1) 577bp
    GenBank:EB931824 (1) 502bp
    GenBank:AI584892 (1) 500bp
    GenBank:BM317095 (1) 485bp
    GenBank:EB937444 (1) 419bp
    GenBank:EB936684 (1) 360bp
    GenBank:EB781150 (1) 206bp
    CITATIONS (2)