Community Action Needed: Please respond to the NIH RFI
Transcript

sin3aa-202

ID
ZDB-TSCRIPT-090929-19095
Name
sin3aa-202
Previous Names
  • sin3aa-002
  • zgc:162128-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038745|OTTDARG00000028452|ZDB-GENE-070620-3 sin3aa|OTTDARP00000031032 CH73-302F10.1-002 LG_ CU207224.8 Danio rerio protein_coding KNOWN, 357 bp
GTTCCAAACACGAATCCGGAGTGCGAGGCTCTTTTTCGCA
GGTCTTGGTGCCCTCTGAGTATGAGTACAGCATGAGGAGG
CGTTTAGAGGATCAGGAGCCAGTGTTCACCCCACAACAAC
GCCGGCTTCCCGGCAGCACTGAGGGCTTCCAGCACAGGGT
TCTGGCCCCAGCGCCTGCTGTATTCGAGGCGGTGGCTGAC
AGCATGCAGCCCACTCCAGGAATACAGTACCCGCTTCCTC
AAGCATACCAGGTGTCCACAGTGGCCCAGAGCTCCAGTGG
TCACAGTCACACTCCTAGTCCGGCAGTGCACAGCGGGCCG
CATCACCATGGCCCGGCGGCGGCTCAAGCCCACGCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations