Transcript

sin3aa-201

ID
ZDB-TSCRIPT-090929-19094
Name
sin3aa-201
Previous Names
  • sin3aa-001
  • zgc:162128-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038744 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038744|OTTDARG00000028452|ZDB-GENE-070620-3 sin3aa|OTTDARP00000031031 CH73-302F10.1-001 LG_ CU207224.8 Danio rerio protein_coding KNOWN, 5189 bp
GTTAGTTGATTTTAAAACTACATTTTAATGTGTTTTATCC
GTGTTTCACGCAGAATTTTAGCATTTCAGCGATATTTTAA
CTGCTTTGGTGAACTGCAAGCGCAGCTAACATAAGCGGGT
CTTGGTGCCCTCTGAGTATGAGTACAGCATGAGGAGGCGT
TTAGAGGATCAGGAGCCAGTGTTCACCCCACAACAACGCC
GGCTTCCCGGCAGCACTGAGGGCTTCCAGCACAGGGTTCT
GGCCCCAGCGCCTGCTGTATTCGAGGCGGTGGCTGACAGC
ATGCAGCCCACTCCAGGAATACAGTACCCGCTTCCTCAAG
CATACCAGGTGTCCACAGTGGCCCAGAGCTCCAGTGGTCA
CAGTCACACTCCTAGTCCGGCAGTGCACAGCGGGCCGCAT
CACCATGGCCCGGCGGCGGCTCAAGCCCACGCTCCTCCAC
CCGTACAGGGTCACGCTCATCCGCCCACCCCGTCTGCATC
CACACAGGGCCAGCAGCAGTTCCAGAGACTCAAGGTGGAG
GATGCTCTGTCTTACCTGGATCAGGTAAAGCTCCAGTTTG
GCAATCAGCCACAGGTCTACAATGACTTCCTGGATATTAT
GAAGGAGTTTAAATCTCAGAGTATTGACACCCCAGGCGTA
ATCAGCAGGGTGTCGCAGCTCTTTAAGGGTCACCCTGATC
TCATTATGGGGTTCAACACGTTTCTTCCACCGGGATACAA
GATTGAAGTTCAGACCAATGACCTGGTCAACGTGACTACA
CCTGGTCAGATCCACCACATCACACCTCACGGCATCTCCG
TGCAGAACATCCCCATCGTACCGCCTCCACCGCCCTCACA
GCAGCAGAACCAGATCACCACAAACCCTCCCAATCTGGCA
ACCACACCTCCTGCTCAACCTGCACCCAAAACCAAGCCTC
TGCAGTCTCCAGTTTTGACTCCGAGCAGTCAGCCCAATCC
GTCTATCCCTCCATACGCATCTCCGCGTTCGCCACCGCTG
CAGCCCAACACCCCGGTCAGCAGCATGCCTATCGCCCCGC
CACTGCAGAACAACCAGCCCGTGGAGTTCAACCACGCCAT
CAACTACGTCAACAAGATCAAGAACCGCTTCCAGGGCCAG
CCCAACATCTACAAGTCCTTCCTGGAGATCCTGCACAAAT
ACCAGAAGGAGCAGCGTAACGCTAAAGAAGCTGGCGGCAG
CTACACCCCAGTTCTGACTGAACAGGAGGTTTACGCTGAA
GTAGCTCAACTCTTCAAAAACCAGGAAGATCTGCTCTCCG
AGTTCGGACAGTTCCTTCCGGACGCCAACAGCACTATGCT
GCTGGGCAAGACGACAGCGGAGAAAGCCGAATCTGTGCGT
AATGATCATGGAGGAACGGTAAAGAAACCGCAGCTCAATA
ACAAACAGAGGCCCAATCAGAATGGCTGTCAGATACGCAA
GCACTCGACTACAGCCATCACACCACCTGTCAAGAAAAAG
CTCAAGTTAATGAACATAAAAGATTCATCCGGAGCAGAAG
CTGGAAAACACGGCGGAGGAACCGAGTCTCTTTTCTTTGA
AAAAGTGCGGAAGGTTTTACGCAGCGCTGAGGCCTATGAC
AACTTCCTTCGGTGCCTGGTCATCTTTAACGAGGAGATCA
TTTCCCGTGCTGAGCTGGTGCAACTTGTGGTTCCTTTCCT
TGGCAAATTTCCTGAGCTGTTCACTTGGTTTAAGAACTTC
CTTGGATATAAGGAGATGTCACACCTGGAGACGTACCCGA
AGGAAAGAGCCACTGAAGGAATTGCCATGGAAATCGACTA
CGCTTCCTGCAAGCGTCTGGGCTCCAGTTACCGAGCGTTA
CCCAAGAGCTACCAGCTGCCCAAGTGCACAGGCAGAACAG
CGATCTGTAAAGAAGTGCTGAATGATACCTGGGTTTCGTT
TCCCTCCTGGTCTGAGGACTCCACCTTTGTGAGCTCCAAG
AAGACTCAGTATGAAGAGCACATGTACAGATGTGAGGACG
AGCGCTTCGAGCTGGATGTGGTACTGGAAACCAACCTGGC
CACCATTCGCGTGCTGGAGACCACGCAAAAGAAGCTGTCT
CGAATGTCAGCCGAGGAACAGGCCAAATTCAGACTAGACA
ACACTCTGGGCGGCTTCTCTGAGATCATTCATAGAAAAGC
CATACAGAGGATATACGGAGACAAAGCTCCAGACATCATA
GACGGACTGAAGAAGAATCCGGCGGCTTCTGTTCCCATCG
TTCTTAAGAGGCTAAAGCTGAAGGAAGAAGAGTGGCGTGA
AGCTCAGAGGGGCTTTAACAAGATCTGGAGGGAGCAGAAC
GAGAAGTACTATCTGAAATCTCTGGACCATCAAGGCATTA
ACTTCAAACAGAACGACACTAAAGTGCTGCGCTCCAAAAC
ACTCCTCAATGAGATCGAGAGCATCTTTGATGAGCGGCAA
GAGCAGGTTTCGGAGGACAACAGCAGCACAACGGCTAGCA
GCCCTCACCTGACGCTAACCTACGAAGACCATCAGATTTT
AGAAGATGCGGCGGCGCTAATAATTCACCACGTGAAACGC
CAAAGCAGCATCAACAAAGAGGACAAATACAAAATCAAGC
AGATCGTCTACCACTTCATCCCCGACATGCTGTTCGCCCA
GAGAGGAGTTTTGTCAGACGTGGAGGAAGAGGACGAAGAG
GAAGACATGGAGCTCGATGAAGGGGCATCCAAAAAGCACA
ACGGGCTCGCTGGAGGAGCTAGCGCAAGCCCTACTAAATC
CAAACTGCTGTTTAGCGCGTCCACGGCTCAGCGGCTTCGC
TCTTGTGAGGACGCGTATAATCTGTTTTACGTCAATAACA
ACTGGTACATCTTTCTTCGGCTGCATCAGATCTTGTGTTC
GCGATTGCTGAGACTTTACGCGCAGGCCGAGCGGCAGATC
GAAGAGGACATGAGGGAGCGCGAGTGGGAGCGGGAGGTGC
TTGGACTCAAACGAGACAAAAATGAAAACACCGCCGTTCA
GCTGCGTCTGAAGGAGCCCATGGATGTGGAAGTGGAGGAT
TATTACTCTGCGTTTCTGGAGATGGTGCGAAACCTGCTGG
ATGGGAATATGGAGGCATCTCAATATGAGGATTCTCTGAG
AGAGATGTTCACCATTCACGCTTACATCGCCTTCACCATG
GACAAACTCATCCAGAATATAGCTAGACAGCTCCAGCACA
TTGTGAGCGAGGAGATCTGCGTTCAGGTGACGGAGCTGTA
CCTGGTTGAGAGTGGTCACTCGTCCACCGGAGGGTCTTTG
CTCACTCAGAGCAGCAGAGCTCAGGCTGAAGCCTCATATC
AGCGCAAAGCAGAGCAGCTCATGTCTGATGAAAACTGCTT
TAAGCTGATGTTCCTGAAGAGCAGAGGAAACGTTCAGCTC
ACGGTGGAGCTGCTGGACACAGAGGAAGAAAACTCAGATG
GGCCGATGGAGATCGAGCGCTGGTCCGATTATGTCATGCG
ATATCTGTCGGCTGATTTCACGTCTCCAGACCTGAAGGAT
CATCTCTCCCAGAAGCCTGTGTTTCTGCCCAGAAACCTGC
GACGCATCCGCAAGTGTCAGCGAGGCTGCGAGGCTCAGGA
GAAGGAGCTGAAGGACGGAGAGAGAAAGGAGAACGCAGAC
AGCATGAAGATGGAGTGCATGTTCAAACTCAACTCCTACA
AGATGGTGTACGTCTTCAAATCCGAGGATTACATGTACAG
ACGCACTGCGCTGCTCAGAGCCCATCAGTCTCATGAACGA
GTGAGCACCCGTCTGCACCAGCGCTTTCACGCCTGGAGTC
AGCGCTGGGCCAAGGAGCACGTGACCCGGGACATGGCTGC
CGAAACCAGCCGCTGGCTCATGGGAGAGGGTCGAGAGGGA
CTGCTGCCCTGCTCCACCAGCTGTGACCCCGAAATCCTTC
ACTTCCAGCGCATCAACAAATACAGAGTCAAATACGGCCC
CACCAACAAGCCCCAGTGACATCAGTGGATAAGGCGGAGC
TCGGCTGATGAGGGCGGAGCTCAGCGGTGAGATTTCATGT
GACCCACGTTGAGGTTTTTAACAGTGTTTCTTTTTTTCCT
CTTTTTTTTTATAAGCTCCTGCATAAAGCGCAGATCACCC
AGTGCCAAAAAAACACAGGGGTGAAGACCTGTCAGTCAAA
CCCAGCCGGACCAATCAGCACAGCTCTCACAGTTTAGACC
AGCCCACAAATCTAATACATTGGATTCTTCTTACTAATAT
TATTTTGAGCTTCACAGGCAGAACATGTGTATGAAAATAA
AGCAAAAATGTTTCGGGGGATAAGTGCACTTAACTGTAAC
GTGAACTAAAATCTGAGGTGCGAATTCAGCATTAGAATTA
ACCGGATTTCACTTTTAGAAATGAAACAAGTTTCAAAAAA
TATAGAGAGATTTAAATGGACAGCAATAAAAGATAGAAGA
CATGTTATGAATCAGAAAAACACTTATTTCTGCACCAGCT
TTCAGCGAATATGACCTGTGAACCACACACACACACACAC
ACTTTCAATAGTTTGTAAATACAGTGTAAATATCGCCAGA
CCTTTTTTATGCCAGATGTGTGTTGTGTTTAGTGTGTTAG
TGTGGCGTTTAGGGAGAAAGGAAAGAAAAAGAAGCGAGAA
CCACATGTGAAAAGGATGGTTTATTACAGTTTTTACCAAA
GGGAGTCGGTTACTATTGTTATTCTAAACGTTGGGGTTTG
TTTTCTTTCTCTATTTGTGCGTTTCTTTTTTTCCTTATCT
GTCTCTTTCTTTCTTTTTTTTTTTTCTTAGTAAAAATGTT
AATTTTGCAAAGTAGAAATGTATCCAGGTTCTTGTTTTTG
GAAATGGAAGTTTTTATAAGAAAAAAAGAAATGGAAAAAA
GCAATTTTAATTTTCGAGGTTTGAATATGGATCTGGTTTC
CGTACACTTTTATCACCGAGCGTTTTTCGGATAAACCTTC
AAAGCTGTGTCCTCTGGCAGACGCTCCTGAATGTAAAGGT
CTTCTCTTTCTCGTCGTCAGAGGCTTCGGTCTTCACTCTG
GATAGATTTCTGCTGGACAAATCTAAATATAAATATATAT
ACACATTTTAAAAATGAGTCACAAAGCATGTCTTTTCTGT
GGATCATTATAGACCCTTTATTTGCATATTATTTAAATTA
ATAAAAATTACATTTGTAGCATAAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations