ZFIN ID: ZDB-TSCRIPT-090929-19094
Transcript Name: sin3aa-201
Previous Names: sin3aa-001, zgc:162128-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038744 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038744|OTTDARG00000028452|ZDB-GENE-070620-3 sin3aa|OTTDARP00000031031 CH73-302F10.1-001 LG_ CU207224.8 Danio rerio protein_coding KNOWN, 5189 bp
GTTAGTTGATTTTAAAACTACATTTTAATGTGTTTTATCC
GTGTTTCACGCAGAATTTTAGCATTTCAGCGATATTTTAA
CTGCTTTGGTGAACTGCAAGCGCAGCTAACATAAGCGGGT
CTTGGTGCCCTCTGAGTATGAGTACAGCATGAGGAGGCGT
TTAGAGGATCAGGAGCCAGTGTTCACCCCACAACAACGCC
GGCTTCCCGGCAGCACTGAGGGCTTCCAGCACAGGGTTCT
GGCCCCAGCGCCTGCTGTATTCGAGGCGGTGGCTGACAGC
ATGCAGCCCACTCCAGGAATACAGTACCCGCTTCCTCAAG
CATACCAGGTGTCCACAGTGGCCCAGAGCTCCAGTGGTCA
CAGTCACACTCCTAGTCCGGCAGTGCACAGCGGGCCGCAT
CACCATGGCCCGGCGGCGGCTCAAGCCCACGCTCCTCCAC
CCGTACAGGGTCACGCTCATCCGCCCACCCCGTCTGCATC
CACACAGGGCCAGCAGCAGTTCCAGAGACTCAAGGTGGAG
GATGCTCTGTCTTACCTGGATCAGGTAAAGCTCCAGTTTG
GCAATCAGCCACAGGTCTACAATGACTTCCTGGATATTAT
GAAGGAGTTTAAATCTCAGAGTATTGACACCCCAGGCGTA
ATCAGCAGGGTGTCGCAGCTCTTTAAGGGTCACCCTGATC
TCATTATGGGGTTCAACACGTTTCTTCCACCGGGATACAA
GATTGAAGTTCAGACCAATGACCTGGTCAACGTGACTACA
CCTGGTCAGATCCACCACATCACACCTCACGGCATCTCCG
TGCAGAACATCCCCATCGTACCGCCTCCACCGCCCTCACA
GCAGCAGAACCAGATCACCACAAACCCTCCCAATCTGGCA
ACCACACCTCCTGCTCAACCTGCACCCAAAACCAAGCCTC
TGCAGTCTCCAGTTTTGACTCCGAGCAGTCAGCCCAATCC
GTCTATCCCTCCATACGCATCTCCGCGTTCGCCACCGCTG
CAGCCCAACACCCCGGTCAGCAGCATGCCTATCGCCCCGC
CACTGCAGAACAACCAGCCCGTGGAGTTCAACCACGCCAT
CAACTACGTCAACAAGATCAAGAACCGCTTCCAGGGCCAG
CCCAACATCTACAAGTCCTTCCTGGAGATCCTGCACAAAT
ACCAGAAGGAGCAGCGTAACGCTAAAGAAGCTGGCGGCAG
CTACACCCCAGTTCTGACTGAACAGGAGGTTTACGCTGAA
GTAGCTCAACTCTTCAAAAACCAGGAAGATCTGCTCTCCG
AGTTCGGACAGTTCCTTCCGGACGCCAACAGCACTATGCT
GCTGGGCAAGACGACAGCGGAGAAAGCCGAATCTGTGCGT
AATGATCATGGAGGAACGGTAAAGAAACCGCAGCTCAATA
ACAAACAGAGGCCCAATCAGAATGGCTGTCAGATACGCAA
GCACTCGACTACAGCCATCACACCACCTGTCAAGAAAAAG
CTCAAGTTAATGAACATAAAAGATTCATCCGGAGCAGAAG
CTGGAAAACACGGCGGAGGAACCGAGTCTCTTTTCTTTGA
AAAAGTGCGGAAGGTTTTACGCAGCGCTGAGGCCTATGAC
AACTTCCTTCGGTGCCTGGTCATCTTTAACGAGGAGATCA
TTTCCCGTGCTGAGCTGGTGCAACTTGTGGTTCCTTTCCT
TGGCAAATTTCCTGAGCTGTTCACTTGGTTTAAGAACTTC
CTTGGATATAAGGAGATGTCACACCTGGAGACGTACCCGA
AGGAAAGAGCCACTGAAGGAATTGCCATGGAAATCGACTA
CGCTTCCTGCAAGCGTCTGGGCTCCAGTTACCGAGCGTTA
CCCAAGAGCTACCAGCTGCCCAAGTGCACAGGCAGAACAG
CGATCTGTAAAGAAGTGCTGAATGATACCTGGGTTTCGTT
TCCCTCCTGGTCTGAGGACTCCACCTTTGTGAGCTCCAAG
AAGACTCAGTATGAAGAGCACATGTACAGATGTGAGGACG
AGCGCTTCGAGCTGGATGTGGTACTGGAAACCAACCTGGC
CACCATTCGCGTGCTGGAGACCACGCAAAAGAAGCTGTCT
CGAATGTCAGCCGAGGAACAGGCCAAATTCAGACTAGACA
ACACTCTGGGCGGCTTCTCTGAGATCATTCATAGAAAAGC
CATACAGAGGATATACGGAGACAAAGCTCCAGACATCATA
GACGGACTGAAGAAGAATCCGGCGGCTTCTGTTCCCATCG
TTCTTAAGAGGCTAAAGCTGAAGGAAGAAGAGTGGCGTGA
AGCTCAGAGGGGCTTTAACAAGATCTGGAGGGAGCAGAAC
GAGAAGTACTATCTGAAATCTCTGGACCATCAAGGCATTA
ACTTCAAACAGAACGACACTAAAGTGCTGCGCTCCAAAAC
ACTCCTCAATGAGATCGAGAGCATCTTTGATGAGCGGCAA
GAGCAGGTTTCGGAGGACAACAGCAGCACAACGGCTAGCA
GCCCTCACCTGACGCTAACCTACGAAGACCATCAGATTTT
AGAAGATGCGGCGGCGCTAATAATTCACCACGTGAAACGC
CAAAGCAGCATCAACAAAGAGGACAAATACAAAATCAAGC
AGATCGTCTACCACTTCATCCCCGACATGCTGTTCGCCCA
GAGAGGAGTTTTGTCAGACGTGGAGGAAGAGGACGAAGAG
GAAGACATGGAGCTCGATGAAGGGGCATCCAAAAAGCACA
ACGGGCTCGCTGGAGGAGCTAGCGCAAGCCCTACTAAATC
CAAACTGCTGTTTAGCGCGTCCACGGCTCAGCGGCTTCGC
TCTTGTGAGGACGCGTATAATCTGTTTTACGTCAATAACA
ACTGGTACATCTTTCTTCGGCTGCATCAGATCTTGTGTTC
GCGATTGCTGAGACTTTACGCGCAGGCCGAGCGGCAGATC
GAAGAGGACATGAGGGAGCGCGAGTGGGAGCGGGAGGTGC
TTGGACTCAAACGAGACAAAAATGAAAACACCGCCGTTCA
GCTGCGTCTGAAGGAGCCCATGGATGTGGAAGTGGAGGAT
TATTACTCTGCGTTTCTGGAGATGGTGCGAAACCTGCTGG
ATGGGAATATGGAGGCATCTCAATATGAGGATTCTCTGAG
AGAGATGTTCACCATTCACGCTTACATCGCCTTCACCATG
GACAAACTCATCCAGAATATAGCTAGACAGCTCCAGCACA
TTGTGAGCGAGGAGATCTGCGTTCAGGTGACGGAGCTGTA
CCTGGTTGAGAGTGGTCACTCGTCCACCGGAGGGTCTTTG
CTCACTCAGAGCAGCAGAGCTCAGGCTGAAGCCTCATATC
AGCGCAAAGCAGAGCAGCTCATGTCTGATGAAAACTGCTT
TAAGCTGATGTTCCTGAAGAGCAGAGGAAACGTTCAGCTC
ACGGTGGAGCTGCTGGACACAGAGGAAGAAAACTCAGATG
GGCCGATGGAGATCGAGCGCTGGTCCGATTATGTCATGCG
ATATCTGTCGGCTGATTTCACGTCTCCAGACCTGAAGGAT
CATCTCTCCCAGAAGCCTGTGTTTCTGCCCAGAAACCTGC
GACGCATCCGCAAGTGTCAGCGAGGCTGCGAGGCTCAGGA
GAAGGAGCTGAAGGACGGAGAGAGAAAGGAGAACGCAGAC
AGCATGAAGATGGAGTGCATGTTCAAACTCAACTCCTACA
AGATGGTGTACGTCTTCAAATCCGAGGATTACATGTACAG
ACGCACTGCGCTGCTCAGAGCCCATCAGTCTCATGAACGA
GTGAGCACCCGTCTGCACCAGCGCTTTCACGCCTGGAGTC
AGCGCTGGGCCAAGGAGCACGTGACCCGGGACATGGCTGC
CGAAACCAGCCGCTGGCTCATGGGAGAGGGTCGAGAGGGA
CTGCTGCCCTGCTCCACCAGCTGTGACCCCGAAATCCTTC
ACTTCCAGCGCATCAACAAATACAGAGTCAAATACGGCCC
CACCAACAAGCCCCAGTGACATCAGTGGATAAGGCGGAGC
TCGGCTGATGAGGGCGGAGCTCAGCGGTGAGATTTCATGT
GACCCACGTTGAGGTTTTTAACAGTGTTTCTTTTTTTCCT
CTTTTTTTTTATAAGCTCCTGCATAAAGCGCAGATCACCC
AGTGCCAAAAAAACACAGGGGTGAAGACCTGTCAGTCAAA
CCCAGCCGGACCAATCAGCACAGCTCTCACAGTTTAGACC
AGCCCACAAATCTAATACATTGGATTCTTCTTACTAATAT
TATTTTGAGCTTCACAGGCAGAACATGTGTATGAAAATAA
AGCAAAAATGTTTCGGGGGATAAGTGCACTTAACTGTAAC
GTGAACTAAAATCTGAGGTGCGAATTCAGCATTAGAATTA
ACCGGATTTCACTTTTAGAAATGAAACAAGTTTCAAAAAA
TATAGAGAGATTTAAATGGACAGCAATAAAAGATAGAAGA
CATGTTATGAATCAGAAAAACACTTATTTCTGCACCAGCT
TTCAGCGAATATGACCTGTGAACCACACACACACACACAC
ACTTTCAATAGTTTGTAAATACAGTGTAAATATCGCCAGA
CCTTTTTTATGCCAGATGTGTGTTGTGTTTAGTGTGTTAG
TGTGGCGTTTAGGGAGAAAGGAAAGAAAAAGAAGCGAGAA
CCACATGTGAAAAGGATGGTTTATTACAGTTTTTACCAAA
GGGAGTCGGTTACTATTGTTATTCTAAACGTTGGGGTTTG
TTTTCTTTCTCTATTTGTGCGTTTCTTTTTTTCCTTATCT
GTCTCTTTCTTTCTTTTTTTTTTTTCTTAGTAAAAATGTT
AATTTTGCAAAGTAGAAATGTATCCAGGTTCTTGTTTTTG
GAAATGGAAGTTTTTATAAGAAAAAAAGAAATGGAAAAAA
GCAATTTTAATTTTCGAGGTTTGAATATGGATCTGGTTTC
CGTACACTTTTATCACCGAGCGTTTTTCGGATAAACCTTC
AAAGCTGTGTCCTCTGGCAGACGCTCCTGAATGTAAAGGT
CTTCTCTTTCTCGTCGTCAGAGGCTTCGGTCTTCACTCTG
GATAGATTTCTGCTGGACAAATCTAAATATAAATATATAT
ACACATTTTAAAAATGAGTCACAAAGCATGTCTTTTCTGT
GGATCATTATAGACCCTTTATTTGCATATTATTTAAATTA
ATAAAAATTACATTTGTAGCATAAACAAA

sin3aa TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA sin3aa-201 5189
sin3aa-202 (1) 357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sin3aa-201 Contained in:
OTHER sin3aa-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038744 (1)
  • Ensembl_Trans:ENSDART00000083539 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139856 (1) 5208bp
    CITATIONS (2)