ZFIN ID: ZDB-TSCRIPT-090929-19093
Transcript Name: snx22-202
Previous Names: snx22-002, zgc:153718-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038743 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038743|OTTDARG00000028451|ZDB-GENE-060825-154 snx22|OTTDARP00000031030 CH211-11I22.2-002 LG_ AL929134.21 Danio rerio protein_coding KNOWN, 839 bp
TCAGAGAGCATTCACAACACTCTTAGTCGAGGTGAGCTTC
AGTCTAGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTTTGA
GATGTTGGACCATCAGTGTGTGTCTCCTGTCATCGAGGTC
TTCATTCCGTCTCTCATGAGGGAAGTGGACGAGACGGGAA
AGTTGCGCAAACTCTTCAGGGTGGAGATTCTCTTCAATGG
AAGGAAGCACTTTGTTTTACGGCGACACGGCGAGTTTCAG
ACGCTTCACAGGAAGGTGAAGAAGATTCTGCGAGTTCCTG
ATTTCCCCAGCAAGAGAAACCAGCATCTGCGAACCAAACC
ACTGGAGCAAAGACGACAAGAACTCGAGGACTACATCCAG
GTGATTCTCTATCAGAATGATGTTGTTCCTCAAGAGCTTC
TGGATTTCCTGCAGGTCAAACATTTTCATCCAACAAGCAA
GAACTGCAGCTCTGAATCTCCCTGATATCGTGGTTGCCGG
TGTCCTGCAGGGTTTTTACCCTAAAGATGTCAAAGTGAGT
TTCAAAAAGAGCTGCGGTAAACCCAGCGGCGTCACCTGTG
CTCCAGCGCTACCCGCGCATCCCAAAATCCCCATTATTAC
CATCAACAGAAGCAGCGTCAGCTCACTGCCAGTATGAGCA
TTGCCTAACAACTTGGTCTCATTTAAATGTGCCTTTACAT
GAGTGTACAGTATCGATTGAATCCTTCTCATGTTAATATT
ACAACCATTTAGATGTTTTTCATGAAAAAATATTGTTTAA
AAATAGCTCTGTTTATCATATTTAGCACAAAAAAGTTGTT
AAATCCTGTACAGTACAACTGTAATCATACATCATCATA

snx22 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA snx22-201 (1)    Ensembl 1053
snx22-202 839
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snx22-202 Contained in:
[BAC] CH211-11I22 (1)

Genome Resources: Vega_Trans:OTTDART00000038743 (1),  Ensembl_Trans:ENSDART00000136054 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT730837 (1) 814 nt
CITATIONS (2)