Transcript

snx22-202

ID
ZDB-TSCRIPT-090929-19093
Name
snx22-202
Previous Names
  • snx22-002
  • zgc:153718-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038743 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038743|OTTDARG00000028451|ZDB-GENE-060825-154 snx22|OTTDARP00000031030 CH211-11I22.2-002 LG_ AL929134.21 Danio rerio protein_coding KNOWN, 839 bp
TCAGAGAGCATTCACAACACTCTTAGTCGAGGTGAGCTTC
AGTCTAGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTTTGA
GATGTTGGACCATCAGTGTGTGTCTCCTGTCATCGAGGTC
TTCATTCCGTCTCTCATGAGGGAAGTGGACGAGACGGGAA
AGTTGCGCAAACTCTTCAGGGTGGAGATTCTCTTCAATGG
AAGGAAGCACTTTGTTTTACGGCGACACGGCGAGTTTCAG
ACGCTTCACAGGAAGGTGAAGAAGATTCTGCGAGTTCCTG
ATTTCCCCAGCAAGAGAAACCAGCATCTGCGAACCAAACC
ACTGGAGCAAAGACGACAAGAACTCGAGGACTACATCCAG
GTGATTCTCTATCAGAATGATGTTGTTCCTCAAGAGCTTC
TGGATTTCCTGCAGGTCAAACATTTTCATCCAACAAGCAA
GAACTGCAGCTCTGAATCTCCCTGATATCGTGGTTGCCGG
TGTCCTGCAGGGTTTTTACCCTAAAGATGTCAAAGTGAGT
TTCAAAAAGAGCTGCGGTAAACCCAGCGGCGTCACCTGTG
CTCCAGCGCTACCCGCGCATCCCAAAATCCCCATTATTAC
CATCAACAGAAGCAGCGTCAGCTCACTGCCAGTATGAGCA
TTGCCTAACAACTTGGTCTCATTTAAATGTGCCTTTACAT
GAGTGTACAGTATCGATTGAATCCTTCTCATGTTAATATT
ACAACCATTTAGATGTTTTTCATGAAAAAATATTGTTTAA
AAATAGCTCTGTTTATCATATTTAGCACAAAAAAGTTGTT
AAATCCTGTACAGTACAACTGTAATCATACATCATCATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations