Transcript

snx22-201

ID
ZDB-TSCRIPT-090929-19092
Name
snx22-201
Previous Names
  • snx22-001
  • zgc:153718-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038742 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038742|OTTDARG00000028451|ZDB-GENE-060825-154 snx22|OTTDARP00000031029 CH211-11I22.2-001 LG_ AL929134.21 Danio rerio protein_coding KNOWN, 1053 bp
ACAACACTCTTAGTCGAGGTGAGCTTCAGTCTAGTTTGTG
TGTGTGTGTGTGTGTGTGTGTGTTTGAGATGTTGGACCAT
CAGTGTGTGTCTCCTGTCATCGAGGTCTTCATTCCGTCTC
TCATGAGGGAAGTGGACGAGACGGGAAAGTTGCGCAAACT
CTTCAGGGTGGAGATTCTCTTCAATGGAAGGAAGCACTTT
GTTTTACGGCGACACGGCGAGTTTCAGACGCTTCACAGGA
AGGTGAAGAAGATTCTGCGAGTTCCTGATTTCCCCAGCAA
GAGAAACCAGCATCTGCGAACCAAACCACTGGAGCAAAGA
CGACAAGAACTCGAGGACTACATCCAGGTGATTCTCTATC
AGAATGATGTTGTTCCTCAAGAGCTTCTGGATTTCCTGCA
GGTCAAACATTTTCATCCAACAAGCAAGAACTGCAGCTCT
GATGAAAACCAGTCAGATTACTGTCGGGAGCAGGAATACA
GATATCAGTCATTTCATCAGCGAGTAGTTGGTTTTTCGGC
TGACCCTTACCAGCTTGAATCCAGATCAGATCTCCCTGAT
ATCGTGGTTGCCGGTGTCCTGCAGGGTTTTTACCCTAAAG
ATGTCAAAGTGAGTTTCAAAAAGAGCTGCGGTAAACCCAG
CGGCGTCACCTGTGCTCCAGCGCTACCCGCGCATCCCAAA
ATCCCCATTATTACCATCAACAGAAGCAGCGTCAGCTCAC
TGCCAGTATGAGCATTGCCTAACAACTTGGTCTCATTTAA
ATGTGCCTTTACATGAGTGTACAGTATCGATTGAATCCTT
CTCATGTTAATATTACAACCATTTAGATGTTTTTCATGAA
AAAATATTGTTTAAAAATAGCTCTGTTTATCATATTTAGC
ACAAAAAAGTTGTTAAATCCTGTACAGTACAACTGTAATC
ATACATCATCATATTCATAACCTTTTACTGTGTTAGAATA
TTATATTATTGTTTGACAAACAGAAGTCATAATGATACTA
AACATAAGGCATATGAACATAACTAACTTGTTAATTAAAT
TCTATAAATAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations