Transcript

rpl23a-002

ID
ZDB-TSCRIPT-090929-18863
Name
rpl23a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038480 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038480|OTTDARG00000028294|ZDB-GENE-030131-7479 rpl23a|no_translation rpl23a-002 LG_ CR749178.8 Danio rerio protein_coding KNOWN, 551 bp
ATGCATTTTATGTTATAAAAATAAAGTTTGTGCAAATTAT
ATACAGTTTTATTTTCATTCAAATCTGTCCCGGCAAAGAC
TGAGGCCAAATCTAAGGCCCTGAAAGCCAAGAAGGCTGTG
CTGAAGGGAGTCCACAGCCAGAAGAAGAAGAAGATCAGGA
CTACCCCGACCTTCCACCGGCCCAAAACCCTGCGTCTGAG
GAGGCAGCCCAAGTACCCTAGGAAAAGCGCTCCACGCAGA
AACAAGTTGGACCATTATGCCATCATCAAGTTCCCCTTGA
CCACTGAGTCGGCCATGAAGAAGATCGAGGACAACAACAC
TCTGGTGTTTATTGTTGACGTAAAGGCAAACAAGCATCAG
ATTAAACATGCCGTCAAGAAACTGTACGACATCGATGTGG
CCAAAGTCAACACACTGATCAGGCCCGATGGCGAAAAGAA
GGCATACGTTCGTCTCGCACCAGATTATGATGCATTGGAT
GTTGCCAACAAGATCGGCATCATCTAAACTGCTTTTGGTC
AGATGTACAGAAGAATAAATGTTTGTAAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations