Transcript

rpl23a-201

ID
ZDB-TSCRIPT-090929-18862
Name
rpl23a-201
Previous Names
  • rpl23a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038479 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038479|OTTDARG00000028294|ZDB-GENE-030131-7479 rpl23a|OTTDARP00000030834 rpl23a-001 LG_ CR749178.8 Danio rerio protein_coding KNOWN, 563 bp
AACCCTGCAATATACTGAAGGAAACCCCTCTCGTTCTTCC
TTTCCCAACATGGCCCCGAAGGCGAAGAAGGAAGCTGTCC
CGGCAAAGACTGAGGCCAAATCTAAGGCCCTGAAAGCCAA
GAAGGCTGTGCTGAAGGGAGTCCACAGCCAGAAGAAGAAG
AAGATCAGGACTACCCCGACCTTCCACCGGCCCAAAACCC
TGCGTCTGAGGAGGCAGCCCAAGTACCCTAGGAAAAGCGC
TCCACGCAGAAACAAGTTGGACCATTATGCCATCATCAAG
TTCCCCTTGACCACTGAGTCGGCCATGAAGAAGATCGAGG
ACAACAACACTCTGGTGTTTATTGTTGACGTAAAGGCAAA
CAAGCATCAGATTAAACATGCCGTCAAGAAACTGTACGAC
ATCGATGTGGCCAAAGTCAACACACTGATCAGGCCCGATG
GCGAAAAGAAGGCATACGTTCGTCTCGCACCAGATTATGA
TGCATTGGATGTTGCCAACAAGATCGGCATCATCTAAACT
GCTTTTGGTCAGATGTACAGAAGAATAAATGTTTGTAAAA
CAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations