ZFIN ID: ZDB-TSCRIPT-090929-18398
Transcript Name: zgc:153292-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038001 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038001|OTTDARG00000028046|ZDB-GENE-060929-1098 zgc:153292|no_translation DKEY-66I24.4-002 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 692 bp
ATTATCAACATGGTAGAAAATCTGGTGAAGAAGCATCCAG
ACAGTTGGCATGTTCATTTGCCTGTTAGCGTGCTGCGATT
TAACTGCAGTGTCCATCCAGAAACCAAACACAGACCCTTG
GTTCTTCATCGGTGTGAGGGAAAAAAGCCTTATACATCAC
CCAGAGATCAGCCACTCAGTGAAGATGATCTTGCAAAGTA
CTCATTCAAAATCCAGAAACCAAATCCTTTAAAAGAAATT
GAGGCACTTAAACGAATATTCCGTGAGTATAACCCTATGC
TGTCTGAAGCATTATCAGTGTCTGCTTTTCCTTTACATCT
GTGGTCATTAACTTTTCAAATTTAACACAGGAGAATCAGC
GGATTGCATTGTTATTTCATGAAGCAAGCTCTGGGTAAGT
GTGAGTTAACAGTACCAAGTTGTTGTTGTTACTTATGGTT
GTTGCTTATTTGTTAATCTCCAGAATGTTCAGTAGTTTTC
TTTTTTTTTCTGTTGCTAGTGTGCCTGAATATCATTACTG
GAGTGTGAGGAAGAAGCTCTGTACAGAACGTATCAATGAA
GGGATGGAGGATAATGAACCCTGGAGTCCAGAGAGACTGT
TATTATGATTGTGACTTTCATATTGAAATATAATGCAACA
TTGTGAATAAATACCTTTTTAATGGTATACAATAGAGTAG
TATTAATATAAA

zgc:153292 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:153292-201 (1)    Ensembl 1534
ncRNA zgc:153292-002 692
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:153292-002 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038001 (1),  Ensembl_Trans:ENSDART00000109119 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT598703 (1) 692 nt
CITATIONS (2)