Transcript

zgc:153292-201

ID
ZDB-TSCRIPT-090929-18397
Name
zgc:153292-201
Previous Names
  • zgc:153292-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000038000 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038000|OTTDARG00000028046|ZDB-GENE-060929-1098 zgc:153292|OTTDARP00000030456 DKEY-66I24.4-001 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 1534 bp
AGCATTCAGTCTGCCACAAAATCCACCAAAGAACCGTTTC
CGGAAAAACAAAACACGCTCGCTGATCTAAATCTAATTGA
AGTTGAGTAAATCCTTTTAAAATGCCAGTGTGCTCCGCGT
ATAAGTGCAAGAAGCGTTCAGACAGAGAGTATAAAGAGGC
ATACAAGAGGGGCGAGTTTTCTTTTCACAAATTCCCGCTG
GAGGACGGCCTGAGGGTCCGAGAATGGCTCCGGCGGATGA
GATGGCAGAACTGGTGGCCCACTGGAAACTCTGTCCTGTG
CTCGGACCATTTTGAGAAGGACTGCTTTGAGCAAGTGGGC
AGCCACAAAAGACTGCGAAAAAGTGCTGTCCCGACTATCT
TTAATTTCCCTAAGCATCTCCAGTGGAAGGTGCCAGCTGT
CAAAAGGCGATCTCTGAATCGTACGCCGGTTGCAGTGCCT
ATTAAACCAAAACCAACCCTAGTGTCAGCACCAGTAACAC
CACGGCTTGAAGGGACATTTGTTCGTGTGAATGTGGATTC
AAATGGTTCCAGCCGTGGACTCTTTCACGCTGGCAGCTTC
CACGATGACTACTGCAAACCTCAGAGCTTTCACTGGATGA
AGCTGTCGGAGGGTGATGGCGAATCTGATGATGACTCTAG
TGACCCTGAAAGTGATGTCACCAGTGATGATGCACCTCTT
GAAACCCCACAAAATCCAAACTCCAAGTTTATCAAGGTGA
CAGAGAGATGGCAGTGGCTGAGTATAGATGTAACCGGGCC
ATTTCAAGAAAGCAAAGGCCCCTACAGTCACATCGTGGTC
ATCTGTGACTATTACACCAAGTGGATTGAAATTTTCCCGA
CAGAAAAGCCTAATTCTGATTCTGTTGCCCTGCTTATGTG
TGATGCCATTTCCCGATATGGTTTTCCTCTAGGGTTTCTC
ACTCCTTGGGGAGCAAGAGGGATTCAGGTCAGAACGGTTA
ACAGAGCACTGAATAACATTTTGATGATAAAGGATATTTC
CCTTGTCTCTCGACATCACCAGGCGTCACAGCTGGAGCCA
CACACTCAGTATCACATTATCAACATGGTAGAAAATCTGG
TGAAGAAGCATCCAGACAGTTGGCATGTTCATTTGCCTGT
TAGCGTGCTGCGATTTAACTGCAGTGTCCATCCAGAAACC
AAACACAGACCCTTGGTTCTTCATCGGTGTGAGGGAAAAA
AGCCTTATACATCACCCAGAGATCAGCCACTCAGTGAAGA
TGATCTTGCAAAGTACTCATTCAAAATCCAGAAACCAAAT
CCTTTAAAAGAAATTGAGGCACTTAAACGAATATTCCGAG
AATCAGCGGATTGCATTGTTATTTCATGAAGCAAGCTCTG
GTGTGCCTGAATATCATTACTGGAGTGTGAGGAAGAAGCT
CTGTACAGAACGTATCAATGAAGGGATGGAGGATAATGAA
CCCTGGAGTCCAGAGAGACTGTTATTATGATTGTGACTTT
CATATTGAAATATAATGCAACATTGTGAATAAATACCTTT
TTAATGGTATACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations