header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18113
Transcript Name: sqstm1-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037713 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037713|OTTDARG00000027873|ZDB-GENE-040426-2204 sqstm1|no_translation sqstm1-003 LG_ CU075768.4 Danio rerio protein_coding KNOWN, 531 bp
GGTGCACCCAGGTGTGACCTGTGACGGGTGTGATGGGCCG
GTGGCTGGAACCCGTTACAAGTGCACCGTTTGCCCCGATT
ATGACTTGTGCCCCACCTGCCAGAGCAAAGGCCTGCACAA
GGAGCATGCCCTCCTGCCCATCTTTCATCCTATGGCCAAC
GTGTTTGAGGTGAATAGCACTATTTTACTACATACAATAC
ACTGCAAATGATCTGAATATTTTGGTTTGATTAATCTTTT
GTGTGCAGTGGCTCCCTCGTGGGAAATTTTGGCGTAAGAT
GAGACACTGCATGTGGGCAAATGCTCAAGCTCAGGCTCAA
AACCAGCCTCAGCCAGGTCCATCTGGAGCGCAGCAAAACC
AGGATGCTCCTGAAAACCCAAATGAGAATGGTGCTACTGC
CTCTTCTCAGGCTAACGTGGAGTACCTAAAGAACATCGGA
GAAGAAGTGGCAGCCATGTTAAGCCCCCTTGGCATAGATG
TGGACATCGATGTTGAGCATGAGGGAAAGCGGACCAAAGT
AACCCCAACTC

sqstm1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA sqstm1-202 (1)    Ensembl 1939
ncRNA sqstm1-003 531
sqstm1-004 (1)    Ensembl 1010
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sqstm1-003 Contained in:
[BAC] DKEY-177P5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037713 (1),  Ensembl_Trans:ENSDART00000141840 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AW566606 (1) 531 bp
CITATIONS (2)