Transcript

hdac3-202

ID
ZDB-TSCRIPT-090929-18106
Name
hdac3-202
Previous Names
  • hdac3-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037706 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037706|OTTDARG00000027868|ZDB-GENE-040426-847 hdac3|OTTDARP00000046830 hdac3-002 LG_ BX927254.15 Danio rerio protein_coding KNOWN, 705 bp
AGGCATCTGGATTTTGTTACGTGAACGACATTGTCATCAG
TATTCTTGAACTCCTGAAGTATCATCCACGTGTGCTCTAC
ATTGACATTGATATTCATCATGGGGATGGTGTACAGGAAG
CATTTTATCTCACAGACAGGGTCATGACTGTGTCCTTCCA
CAAATATGGGAACTATTTTTTCCCAGGAACTGACAACTTT
TTCAGCCAGTTATCAAGCAGGTGGTAGACTTTTATCAGCC
AACCTGTATTGTTCTTCAGTGTGGAGCAGATTCTTTGGGA
TGTGATCGATTAGGATGCTTTAATCTCAGCATACGAGGAC
ATGGAGAATGTGTGGAGTTTGTGAAGGGCTTCAAAATTCC
GCTGCTTGTTCTGGGTGGAGGAGGGTACACCGTGAGGAAT
GTGGCTAGATGTTGGACATTTGAAACATCATTGCTTGTTG
AGGAGTCAATTAGTGATGAACTTCCATATAGTGAATACTT
TGAATATTTTGCTCCAGACTTCACACTTCATCCAGATGTC
AGCACAAGGATAGAAAACCAAAATTCTAGACAATATTTGG
AACAAATTCGTCAAACTGTGTTTGAAAATTTGAAGATGTT
GAATCATGCACCAAGTGTCCAGATCCACGACGTTCCCTCT
GATTTGCTGAGCTACGAGCGACCAGACGAGGCTGATCCTG
AAGAGAGAGGATCAGAAGAGAACTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations