Transcript

hdac3-201

ID
ZDB-TSCRIPT-090929-18105
Name
hdac3-201
Previous Names
  • hdac3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037705 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037705|OTTDARG00000027868|ZDB-GENE-040426-847 hdac3|OTTDARP00000030226 hdac3-001 LG_ BX927254.15 Danio rerio protein_coding KNOWN, 2138 bp
TCCTTCGCATTGCCACTCCACACCCCAGTTCAGTTGGTGG
CGGTAAGGCACCAAAAGTTGGATTTGACACCATCAAGAAG
AAGAAGAAGCGGAAGTGATTTTTTTTTGCTGTTTTAGAGA
AGATGGCGGCGGCGTTGAACAGAAATTAGAATAATTAAAA
CATTTTTGTTTTCTCGTGCTAGAAATAACTGCTTTTATTT
ACACTCTGTTGCAACATGACCAATCGAACTGCGTACTTCT
ACGACCCAGACGTGGGGAACTTTCACTATGGTGCTGGGCA
TCCAATGAAACCTCATAGACTATCACTCACACATAGTCTT
GTACTTCATTATGGACTATACAAGAAGATGATGGTTTTCA
AACCCTACAAGGCATCCCAGCATGACATGTGCAGGTTCCA
CTCTGAGGATTACATAGACTTTCTGCAGAAGGTCAGTCCA
AACAACATGCAGGGCTTCACAAAGAGTCTCAACACTTTCA
ATGTAGGAGATGACTGTCCTGTCTTTCCAGGTCTGTTTGA
GTTTTGTTCAAGATACACAGGTGCCTCATTACAAGGAGCA
ACTCAGTTAAATCACAAGATTTGTGACATTGCTATAAACT
GGGCGGGAGGTTTACATCATGCAAAAAAGTTTGAGGCATC
TGGATTTTGTTACGTGAACGACATTGTCATCAGTATTCTT
GAACTCCTGAAGTATCATCCACGTGTGCTCTACATTGACA
TTGATATTCATCATGGGGATGGTGTACAGGAAGCATTTTA
TCTCACAGACAGGGTCATGACTGTGTCCTTCCACAAATAT
GGGAACTATTTTTTCCCAGGAACTGGTGACATGTATGAAG
TGGGGGCTGAGAGCGGCCGCTATTACTGCTTGAATGTCCC
TCTGCGAGATGGCATTGATGACCAGAGTTACAGACAACTT
TTTCAGCCAGTTATCAAGCAGGTGGTAGACTTTTATCAGC
CAACCTGTATTGTTCTTCAGTGTGGAGCAGATTCTTTGGG
ATGTGATCGATTAGGATGCTTTAATCTCAGCATACGAGGA
CATGGAGAATGTGTGGAGTTTGTGAAGGGCTTCAAAATTC
CGCTGCTTGTTCTGGGTGGAGGAGGGTACACCGTGAGGAA
TGTGGCTAGATGTTGGACATTTGAAACATCATTGCTTGTT
GAGGAGTCAATTAGTGATGAACTTCCATATAGTGAATACT
TTGAATATTTTGCTCCAGACTTCACACTTCATCCAGATGT
CAGCACAAGGATAGAAAACCAAAATTCTAGACAATATTTG
GAACAAATTCGTCAAACTGTGTTTGAAAATTTGAAGATGT
TGAATCATGCACCAAGTGTCCAGATCCACGACGTTCCCTC
TGATTTGCTGAGCTACGAGCGACCAGACGAGGCTGATCCT
GAAGAGAGAGGATCAGAAGAGAACTTTTCTAGACCTGAAG
CTGCGAATGAATTTTATGATGGTGACCATGATCATGATAA
AGAAAGTGATGTGGAGATCTGAAGACTTTTTTGTGCAGTG
TACCTGTCTTTGGTCTTCAGCCATGAAGGTGTCCATTCCT
TGCAGTATCTACAGTACTTGACTGTGATGTGTGGGTAAAA
GTCAATCATTTTTTTAACATGTCGAAATTGTGTAGTTCAC
CATATGTAGGTCTTTATATTGTATTTTTCTGTTTATCAAA
TTTTAAGTAAAAAAGGGAACTTTACAATGAGTCCTGCAAG
CAGCTTCTGCTGCATTTGTATTCAGAGGGTTCAACAATAA
TGTGATGAATGATGGCTTTGTGTGCCTAATATCCAAGTGT
TTTGATTTAGAGAAAATAAAATCTATTTGAAATGAGCCTT
TCTATCTAAAACATCTATTTACACAGTCTGACCCTAAGAA
CTATCTAAAATGTGGCGGATCACCAGTGCTGTTTGTTATT
TTAATTATTTGGCAGCTGTCTTGTTTTGTTGTATTTTGTT
ATAGTATGTCTCATAGTTTGAGTTTTGTATGTTAAGAATA
TGACATGGTGGAGGAAACAACTAGGAGATAAATGTATAAT
ATTTTCACAAAAATGTTATTCAAAATTTCATGTCACAAGT
CACAACAAATAACACATTTTTTTTGTATTCTCAACTGTAA
TAAAAACATTTTACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations