ZFIN ID: ZDB-TSCRIPT-090929-17895
Transcript Name: vcla-002
Previous Name: vcl-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037484 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037484|OTTDARG00000027752|ZDB-GENE-050506-61 vcla|no_translation vcl-002 LG_none CR788251.13,CT025777.6,CR762430.12 Danio rerio protein_coding KNOWN, 491 bp
AGAACTGGTTAAAGCAGCTTCAGATGAACTCGGTAGAACC
ATCTCACCCATGGTTATGGCTGCTAAAGGAGTGGCAGGAA
ACATCCAGGATCCAGGTCTTTGTTGTAACTGTTCTTCTAA
TATATTTAGAAAAAACACTTCTGTGATTACTGAAAGAATA
TTTTTAAATCTACTGAGCAGGTTTGCAAAAGGGCTTCCTG
GACTCTGGCTACAGGATCTTGGCTGCTGTTGGGAAAGTCA
GAGAAGCCTTTCAGCCTCAGGAGCTGGACTTTCCTCCGCC
ACCTCCAGACCTGGATCAGCTGCATGTCAATGATGACCAG
GCTCCACCCAAACCACCTCTTCCTGAGGGAGAGGTTCCTC
CGCCGAGACCTCCACCTCCAGAAGAGAAAGATGAGGAGTT
CCCTGAGCAGAAGGCAGGAGAGATGGTGAGCGAGCCCATG
ATGGTGGCTGCCAGGTCACTGCACGACGAGGCCCGCAAGT
GGTCCAGCAAG

vcla TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vcla-202 (1)    Ensembl 4069
ncRNA vcla-002 491
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vcla-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037484 (1),  Ensembl_Trans:ENSDART00000133413 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AI617823 (1) 560 bp
CITATIONS (2)