header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17894
Transcript Name: vcla-202
Previous Names: vcl-001, vcla-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037483 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037483|OTTDARG00000027752|ZDB-GENE-050506-61 vcla|OTTDARP00000030041 vcl-001 LG_none CR788251.13,CT025777.6,CR762430.12 Danio rerio protein_coding KNOWN, 4069 bp
GGGCGCCGTGCTTTGGTTTCTCCACTGAAGGCGTCAGTCG
CTGAGGAGGCGTTCAGGGATTTCTCTCTTTGCATGAGTGG
AGCAAACCCGGGAATAGACGTCTGGTTCGTGGTGCCCTTG
GAAGAAATCACGGGGAAAGCGCAGGACAGAGCCGAACACG
TGCCTTTTTCTCACTTGTGCTGAGGATATTAAGATTTCAG
GATGCCAGTTTTCCATACCAAGACGATAGAGAGTATCCTG
GAGCCGGTGGCTCAGCAGATTTCACACTTGGTTATCATGC
ACGAGGAGGGAGAAGTTGATGGGAAAGCGATCCCAGATCT
CACCAGCCCAGTGGCGGCAGTGCAAGCGGCTGTCAGCAAC
CTTGTGCGGGTGGGGAAGGAGACAGTGCAGACCACAGAAG
ACAAGATTATGAAGAGAGACATGCCATCAGCCTTCATTAA
GGTGGAGAACGCCTGTGCAAAGCTGGTGGAAGCAGCTCAG
ATGCTGAGAACAGACCCGTACTCTGTCCCGGCCCGTGATT
ACCTCATCGACGGCTCTCGTGGAATCCTCTCAGGCACCTC
AGACCTGCTGCTGACCTTCGATGAAGCCGAGGTGCGTAAA
ATTATCCGCGTGTGTAAGGGCATCCTGGAATACCTGACTG
TTGCAGAGGTTGTGGAAACCATGGAGGACTTGATCACTTA
CACTAAAAACCTGGGACCAGGCATGACGAAGATGGCAAAG
ATGATTGACGAGCGGCAGCAGGAACTCACGCACCAGGAGC
ACCGCGTAATGTTGGTCACCTCCATGAACACAGTAAAGGA
GCTGCTGCCCGTGCTTATATCAGCCATTAAAATCTTTGTG
ACAACCAAGTGCACTAAGAGTCACGGTGTGGAGGAGGCCT
TGAAGAACAGAAACTACACGTTTGATAAGATGACAGCTGA
AATCAACGAGATAATCAGAGTGCTGCAGCTCACTTCATGG
GACGAGGACGCCTGGGCAAATAAAGACACTGAGGCCATGA
AGAGAGCGCTGGCGCTGATCGAGTCTAAGATGGGTCAGGC
TAAAGGCTGGCTGAGGGACCCCAATGCACTGCCAGGAGAT
CCAGGAGAGCATGCGCTGCGTCAGATCCTGGATGAAGCAG
GAAAAGTGGGTGAGCTTTGTGCAGGGAAAGAGAGACGAGA
GATCCTGGGAACAGCCAAAACCCTGGGCCAGATGACGGAT
CAGGTGTCAGATGTGCGCGCCAGAGGTCAGGGTGCCACAC
CTATGGGTATGCAGAAAGCTCAGCAGGTTGCTCAAGGTTT
GGATATTCTGGTGGGAAAAGTGGAGAACGCAGCCCGTAAG
CTGGAGGCCCTAACCAATGCCAAACAGGCCATCGCCAAGA
GAATCGACAATGCCCAGAGCTGGCTGGCTGATCCTAACGG
CGGTCCAGAGGGTGAAGAAAACATCCGCGCTCTTCTGGCG
GAAGCCAAACGCATCGCTGACTTGTGTGAAGACCCTAAAG
AACGAGATGACATTCTTCGTTCCATCGGCGAGATCGCAGG
CCTCACCGCCAGGCTGGTCGAGCTCCGTAGAATAGGTAAA
GGCGATACTCCAGAGGCGAGAGCTCTTGCCAAACAGATTG
GCACAGCTTTGCAGAACTTACAGGCAAAAACGAACCGTGC
TGTGGCCAACATGAGGCCTGCCAAAGCTGCTGTTACCCTG
GAGGGCAAAATGGAGCAGGCCTTGCGCTGGATCAACAACC
CTGGAGTGGACGATCATGGAGTAGGCCAGGCTGCTATACG
AGGGCTGATAGCAGAGGGTCGACGGCTCGCGAGCTCTCTG
CCAGGGCCGTACAGACAGGAGCTGCTGGCCAAATGTGAGC
AGGTGGAGCAGCTGATGATGCAGCTGGCGGATCTGGCAGC
GCGGGGAGAAGGAGAGAGTCCTCAGGCCCGCGCAGTGGCT
GCTCATCTTCTGGAGGCAATTAAAGATCTGAAGGCAAAGA
TGCAGGAAGCAATGACCCAGGAAGTGTCTGATGTTTTCAG
CGATACAACAACACCAATTAAACTCCTGGCTGTGGCAGCA
ACAGCACCTCTCGAGGCCCCGAACAGAGAGGAGGTGTTTG
AAGAAAGGGCTTCTAACTTTGAGAATCATGCTAGCAGGCT
GGGTGCTACTGCGGAGAAGGCGGCTGCGGTAGGAACAGCC
AATAAAAGCACAGTTGAAGGCATCCAAGCGGCTGTGAAAT
CAGCTAGAGATCTAACACCTCAGCAGGTCACTTCCGCTGC
ACGTATTTTGCTGAAGAACCCTGGCAACCAGGCCGCCTAC
GAGCACTTTGATACCATGAAGAACCAGTGGATTGACAACA
TTGAAAAAATGACCAGTCTTGTGGATGAAGCCATTGACAC
TAAATCCCTCTTGGATGCTTCAGAGGAAGCTATTAAGAAA
GACATTGATAAATGCCGTGTAGCAATGGCTAACGTTCAGC
CCCAGATGTTGGTTGCAGGGGCTACAAGCATTGCCCGGCG
GGCAAACAGAGTACTTCTGGTGGCCAAGAGGGAAGTGGAG
AATTCAGAGGACCCTAAATTCAGAGAACTGGTTAAAGCAG
CTTCAGATGAACTCGGTAGAACCATCTCACCCATGGTTAT
GGCTGCTAAAGGAGTGGCAGGAAACATCCAGGATCCAGGT
TTGCAAAAGGGCTTCCTGGACTCTGGCTACAGGATCTTGG
CTGCTGTTGGGAAAGTCAGAGAAGCCTTTCAGCCTCAGGA
GCTGGACTTTCCTCCGCCACCTCCAGACCTGGATCAGCTG
CATGTCAATGATGACCAGGCTCCACCCAAACCACCTCTTC
CTGAGGGAGAGGTTCCTCCGCCGAGACCTCCACCTCCAGA
AGAGAAAGATGAGGAGTTCCCTGAGCAGAAGGCAGGAGAG
ATGGTGAGCGAGCCCATGATGGTGGCTGCCAGGTCACTGC
ACGACGAGGCCCGCAAGTGGTCCAGCAAGCCCGAGGTCCC
AGATGAGGGTTTTGAGGCCGCTGAGGCGGAAGTAGATATA
GACGATGAGGATGAATTCACAGACAACGAGGACGATTATG
AGCCAGAGCTGCTCTTAATGTCTTCCAATCAGCCAGTTAA
CCAGCCCATTCTGGCCGCTGCGCAGTCTTTGCACCAGGAG
GCTCGCAAGTGGTCCAGTAAGGGTAATGACATCATTGGAG
CCGCCAAGCGTATGGCCCTGCTGATGGCAGAGATGTCTCG
TCTGGTGCGTGGTGGAAGTGGGAATAAACGTGCCCTTATT
CAGTGCGCCAAGGACATCGCCAAGGCCTCTGATGAGGTCA
CGCGGCTGGCTAAAGAAGTAGCCAAACAATGTACTGACAA
AAGGATTCGCACAAACCTGCTGCAGGTTTGTGAGCGCATC
CCAACCATCAGCACTCAGTTGAAGATCCTTTCCACAGTGA
AGGCCACTATGCTGGGACGTACAAATATCAGTGAGGAAGA
ATCCGAACAGGCCACTGAGATGCTTGTGCACAACGCCCAG
AACCTCATGCAGTCTGTGAAGGAGACGGTGAGAGAAGCAG
AAGCCGCTTCCATCAAGATCCGCACAGACGCAGGCTTCAC
ACTTCGCTGGGTCCGAAAAACCCCCTGGTACCAGTAAAAA
ACAAACTGAGGACTAGATGTTTTCAGTTAGCAGTTTGCAT
CCCTGCCTTTTCAAATGTCCCACATCTGAGAGGAGGTGGA
CTTTTGGACATCAGCGTTTGGTTCTAGTTTCGAGGTGATT
TTTTTATTTAACTGCTGGTATTGGTACTCGGTACACTTAC
TTTGTCTTTACGGAGGCTATTTTTGTCCTGAATCTCACAC
TACTGAGGTATGGTGTTGGAATACACAGGAAGCAGATTTA
TAAATATATATTTTTGGTATGTTGGGTTTCCAAATTCCAG
GTATATATACATAAATATCTATTTTTTCGCATGATGAAGT
TTTCTATTTTGTATTGGAGAAATATGGCACTACGCCTCTC
TTGAACAATGTTGGGAGTTCGTTAATGAATTTAGTTTCGT
TTTTGAAGAGGTGAATTTTCTTATTGAAAATGTATATATT
TCGTACATATTTCACCAGATCGTTATCGC

vcla TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA vcla-202 4069
ncRNA vcla-002 (1)    Ensembl 491
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vcla-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037483 (1),  Ensembl_Trans:ENSDART00000124167 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC133999 (1) 1657 bp
GenBank:BC092958 (1) 1655 bp
GenBank:EE706530 (1) 928 bp
GenBank:EB891341 (1) 622 bp
GenBank:CK683148 (1) 359 bp
CITATIONS (2)