header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17843
Transcript Name: ece1-202
Previous Names: ece1-002, zgc:154079-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037422 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037422|OTTDARG00000027719|ZDB-GENE-061110-100 ece1|OTTDARP00000029991 ece1-002 LG_none CR792452.7,BX248318.9 Danio rerio protein_coding KNOWN, 525 bp
ACTGACTTGACGTCGTTTGATACAATACGTCCACCAGAAA
GTGTACAGCTGTCTAGCAAGAGAGAGAAAGAGAAAGAGAG
AGAAGAGAGATACATGCTATGATGTCTACTTATAAACGGG
CCACGCTGGAGGAAGAGGAGCTGTTGGACACCGGTTCTGA
TGGGATCTACCACACCTCTAGCATGCAGGTTGGTGTACAG
CGTGGTCTGGGTCTCAGATGCTGGGCAGAAAAAACCCACT
CCGAGAGAAAACTTGTGGTCCTTGTGTGCGCTCTTTCTGT
GGCTCTGTTCATCTGCATCATGTCTTTGGGTCTGCACTAT
AAAGAATCTCATCCAGGTCTGTGCCTGTCGGAGCCATGTG
TGAGTGTAGCCAGTGCAGTTCTGGGGTCTCTCGACCGGTC
GGTGGACCCCTGCCAGGACTTTTATAACTTCGCATGTGGA
GGCTGGATGAGGAAAAACCCCCTGCCTGAGGGCAAGTCCC
GCTGGGGGCCTTTCAGCAACCTGTGGGAACATAACATGGC
TGTCA

ece1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ece1-201 (1)    Ensembl 3293
ece1-202 525
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ece1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037422 (1),  Ensembl_Trans:ENSDART00000147386 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD283735 (1) 532 bp
GenBank:EB883800 (1) 526 bp
CITATIONS (2)