ZFIN ID: ZDB-TSCRIPT-090929-17842
Transcript Name: ece1-201
Previous Names: ece1-001, zgc:154079-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037421 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037421|OTTDARG00000027719|ZDB-GENE-061110-100 ece1|OTTDARP00000029990 ece1-001 LG_none CR792452.7,BX248318.9 Danio rerio protein_coding KNOWN, 3293 bp
CAGCACTGTCCCGAAAAATGTTGAGCTCTTTCATCGTCGT
CCAGCATGTGGAATATTAGAAACAGGTGTCCTTTTACTCC
GTGCCCTATTTCTTTGTAGAAATTTAAAGAAGTTTGAAGT
ACATTTCCCTCAGATGTCTACTTATAAACGGGCCACGCTG
GAGGAAGAGGAGCTGTTGGACACCGGTTCTGATGGGATCT
ACCACACCTCTAGCATGCAGGTTGGTGTACAGCGTGGTCT
GGGTCTCAGATGCTGGGCAGAAAAAACCCACTCCGAGAGA
AAACTTGTGGTCCTTGTGTGCGCTCTTTCTGTGGCTCTGT
TCATCTGCATCATGTCTTTGGGTCTGCACTATAAAGAATC
TCATCCAGGTCTGTGCCTGTCGGAGCCATGTGTGAGTGTA
GCCAGTGCAGTTCTGGGGTCTCTCGACCGGTCGGTGGACC
CCTGCCAGGACTTTTATAACTTCGCATGTGGAGGCTGGAT
GAGGAAAAACCCCCTGCCTGAGGGCAAGTCCCGCTGGGGG
CCTTTCAGCAACCTGTGGGAACATAACATGGCTGTCATGA
AGAACTTGCTAGAGAACACCAGCATGAAAAGCTTGAGCAG
AGCAGAGCAGAAAGCCCAGTGGTATTACCAAGCCTGCATG
AACGAGAGCAAAATTGAAGAGCTTGGAGCAAAACCACTCC
AGGACCTCATCAATCAGACGGGAGGCTGGGGCTTGAAAGG
CCCGTGGGAGAAGGATAACTTCCAGGAGGTTTTACGGATT
GTGTCAGCCAACTTCCGAACCTCTCCCTTTTTCACTGTTT
TTGTCAGCACAGACTCAAAAAGCTCCAACAGCAACATCAT
ACAGGTGGATCAGTCAGGATTGGGACTCCCCTCTAGGGAA
TACTATCTCAATAAGACCGCCAATGAAAAGTATTTAAATG
CTTACTTGAACTTTTTGGTGGAACTTGGAGTCCTCTTGGG
CGGCTCACAGGACACCTCGCAGAAAATGATGGAGGAGATC
ATCGAGTTTGAAACCACCCTGGCAAACATTACTGTGCCTC
AGGTGGAGCGACGGGATGAGGAGAAAATATATTATAAAAT
CCAAGCCAAAGAGTTGGCGACATTGGCTCCTGCCATAGAC
TGGATGCCTTTCCTGTCTTCTGTTTTTGCCCCGGTTGAAC
TAAATGATTCTGAACCTGTGGTCGTATACGCTAAAGAATA
CCTCCAGAAAGTCTCCGAGCTCATCAGCAACACAAACAAA
AGTGTCTTAAACAACTACATGATCATGAAAGTGGTGCGGA
AAATGGTGTCCATCTTAGACCAGAAGTTCCAGGATGCAGA
GCAGCGTTTCCTTGAAGTCATGTACGGCACCAAGAAGAGC
TGCATGCCACGCTGGAAACTTTGCGTCAGCGACACGGACA
GCGCTCTGGGCTTTGCTCTCGGGGCGCTCTTTGTCAAAGC
TACTTTTTCCGAAGACAGCAAAGCTTTTGTTGAAGATATG
GTCTCCGAGATCAAATGGGCCTTTGAAGACAGCTTGAAGA
CTGTCAGCTGGATGGATCCCGAGACAAAAAAAGCAGCCAA
AGAAAAGGCTGATGCAATATACAACATGGTGGGTTATCCA
AAATTTATTATGAACCCCAAAGAGCTGGACAAGGTGTTTA
ATGATTTTGATGTTGTTTCAGATCTCTACTTTCAAAATGT
CATGAATTATTACAACTTCTCTGCACGAGTGACTGCTGAC
CAGCTGAGAAAAGCCCCCAACAGAGATCAATGGAGTATGA
CTCCACCTACTGTCAATGCCTACTACAACCCGACAAAGAA
TGAGATGGTTCTTCCTGCAGGCATTTTCCAGGCTCCCTTT
TACAACCACGCTTGGCCAAAAGCCATGAATTTCGGTGGGA
TAGGTGTGGTTATGGGGCACGAACTCACCCATGCTTTTGA
TGATCAAGGACGCAAATATGACAAGGATGGAAATCTTGCA
AAATGGTGGCAAAATTCGTCAGTGGAAGCTTTTCAACACC
AGACCCAGTGCATGGTGGAGCAATACAGCAACTACAGTAT
TAACAATGAACCCCTGAATGGAAAACACACTTTGGGAGAA
AACATCGCTGACAACGGAGGCCTGAATGCGGCTTACAAGG
CTTATGTAAACTGGATCAAGAAGAACGGCGAGGAGGCCAG
TCTGCCTGCCCTTGGGATGAACAACCATCAACTGTTTTTT
GTGGGATTTGCTCAGGTGTGGTGCTCTGTACGGACTCCTG
AAAGCTCTCACGAGGGCGTCATCACTGACCCTCACAGTCC
TTCACGCTTCCGGGTCATCGGCACCATCTCCAATTCTCAC
GAATTCTCTGAGCACTTCGGCTGTAAGGCAGATTCACCCA
TGAACCCTAAACGCAAGTGTGAGCTTTGGTGACAGTGAGA
TTGAACCTGGAGCAGTTACCCTGCAAAAAATATGCCAAAC
GTCTGTCTCAGGTTACCTCATATTGACTGCCAGGTCACTG
ACAGTGGACTTATTTTCCCGCCTCTTAATGGGAAGCTGGT
GTAAATAGAGACTCCATGGACATCTATATAATGGAGTTTT
ATTCTTCTCGAAACACTGGAAGTTAGTGCTATAATGTAAT
AGGAAGGAATTGTGCTTTTTGCTGGTGTTTTCTTTGAATA
CATGCCTTTTATAAGCAAATGCTTTTATTTTTTTATTGGG
AAATACTATTTATGTTCTCTGTGATATGTTGTGGGGGATT
GTTTGATTTCTTTTCAACTGTAATGTTCGCCAATTCTTAC
ACAACATCAATAACATCACTCACATTTTGAAACACGTGTT
TGGTCCAACACATACTATCTGTACAATTTGCCTGTGCAAT
ATGTGAAGCTGATTTTGGGTGAATGATCAGATTGTAAATG
AAGAATGTATATGTGAGCAGTATACACACAGTTTAATTGG
GTTTATTTTTGTACTGCATTATACGAAAGTGGATAGTTCA
GCTAAAAATGAAAATGCTGACATAAGTTACTCACCTCTGA
ACACAAAGGAAGATATTTTTAAGAATGCTGGAATGTGGTA
CCATTGACATAGTATTTTTCAACCATGGATGCTAATGGTT
ACCATTCTCCAGCATTCTTCAAATTATTTTCTTTTTTTGT
CAAGGGAAATGAAAATTCATAAAGATTTGAATCCATATGA
GGATGAGTGCAGTTTTGTTTTGATGTGAGCCATCACTTTA
AGGCACCTTTTCATGGCTGATTTAAATGTTCATTGAAAGT
GTTCAAGTCATAAATAACTTTATATTCAGTAAAATATTCA
GGATTTGTCATTA

ece1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ece1-201 3293
ece1-202 (1)    Ensembl 525
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ece1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037421 (1),  Ensembl_Trans:ENSDART00000136859 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC125952 (1) 2580 bp
GenBank:BM182828 (1) 669 bp
CITATIONS (2)