ZFIN ID: ZDB-TSCRIPT-090929-17734
Transcript Name: gata1a-002
Previous Name: gata1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037311 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037311|OTTDARG00000027654|ZDB-GENE-980526-268 gata1a|no_translation gata1a-002 LG_ CR932000.4 Danio rerio protein_coding KNOWN, 730 bp
CAACATCGATGTTGCAATGTCATTAAAATACATTCAGTTA
AATAGACTTTGGCATTCATTTAGTTGCTCAAGCGCAAAAC
AAGACAAAATGCCGTTTACTCGCACGCACCCATCAGAATC
GGCAGGCTAGCACAGAAGCTCCACTGAATATACTGGGGTA
AAATAAATGCTCATATTATAAAGACATGGTGGGGAAAAAT
GTAATTTAATGCGGTGCTTCTTGTACAATCTGAGACCAGC
TTTATATTAGATATCACTCAGCCAGTGGAGATGGCTGATT
TTTAAAGAAAACAGACCTTAAACGATTTTGCAATGGCATT
TAGTTCACCAGAAGCGTTTAATCTGTGGCAAATTAAAAGT
CCTGTTAGCATACTTTGGCATATACCCCATTGGTTATAAT
GAACTAAATAATTATACAAAAAATTGTCTCCTGCATCAGA
TTGTCAGCAAACGTGCTGGAACGCAGTGCGCCAACTGCCA
CACTAGTACTACAACACTATGGAGACGCAATGCCAGCGGC
GAGCCTGTGTGCAACGCCTGCGGCCTTTATTTTAAACTAC
ACAATGTCAACAGGCCTTTGACAATGAAGAAGGATGGCAT
ACAAACTCGAAACCGCAAGGTTTCAAACAGAAACAAGAAG
GGCAAAAAGAATGCAGCTTCAGAAGTTTATCCTGACATGT
CTCACATGGCACCTCCAGATGAGCATGTAGGAGCGTATTC
TCTGAACCCA

gata1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gata1a-201 (1)    Ensembl 1657
ncRNA gata1a-002 730
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gata1a-002 Contained in:
[BAC] DKEYP-97E7 (1)

Genome Resources: Vega_Trans:OTTDART00000037311 (1),  Ensembl_Trans:ENSDART00000143727 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB989280 (1) 730 bp
CITATIONS (2)