ZFIN ID: ZDB-TSCRIPT-090929-17733
Transcript Name: gata1a-201
Previous Names: gata1-001, gata1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037310 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037310|OTTDARG00000027654|ZDB-GENE-980526-268 gata1a|OTTDARP00000029896 gata1a-001 LG_ CR932000.4 Danio rerio protein_coding KNOWN, 1657 bp
GAGATAAGCAAGCAAACAGGCGGCTAGTTCACTCCATGAT
CTGAGAATCTCCTGATACTGATAAACGACATCTTCAATAC
TACACTTGCAGATGGAGAACTCCTCTGAGCCTTCTCGTTG
GGTGTCCCCCGGTCTGCTCAGTCCAGACCCATTGGTAAAC
TACACAACAGACTCTGGTTTACTGCCACCCGTTGATGTAG
ATGAACCTTTCTACTCCAGCTCTGAGACTGACCTACTGCC
ATCGTATTATTCCACCAGCGTCCAGAGCCGAGCCTCGTCA
TCCTATAGACACAGTCCAGTTCGCCAAGTTTACTCATCTC
AGTCAATTCTGGGAAACATCCAATGGCTAGACAACTCTGC
AGGTCACTCTCTAAACTCTCCCTACAACCCCACATCCACG
GTCTGGTCCAGTAGCCCTTTCGCAAAAACACCTCTCCACT
CTCACACCTCCACGTCCATCTACCAGAACACTGCCACTCC
ATCTTTCACCTCCCCCAAAGAGGGCTTCCCTTCCCCGAGT
CGTGATGGGAAAGACAGTCCCAGGCTCCAGGAAGTCCTGA
AAGCCGAGCGCTTGAGTCCCATGAGTGGAAGTGGAAGCAG
CTTTCTCAATCTGAGTTCAGCCACTGGAGGAGTTTACGGC
CCTTCTCCACACATGCTGAGTCCATATGGATCCTACATGA
GCACATCTCAAGACTACAGTTCAGCAGCGCTCTATTCAAC
TGGGGGACCCTGGATGAGCCCTTCATCGTACTCACCCAAA
CTGCGCAACAAGATGAGACTTTCGCCACCTGAGGCTCGTG
AATGTGTGAATTGTGGTGCCACCGCCACCCCTCTGTGGCG
TCGAGATGGGACAGGCCACTACCTCTGTAATGCTTGTGGA
CTGTACCATAAGATGAACGGCCAGAACAGACCCCTCATCA
GACCAAAAAAGAGGCTGATTGTCAGCAAACGTGCTGGAAC
GCAGTGCGCCAACTGCCACACTAGTACTACAACACTATGG
AGACGCAATGCCAGCGGCGAGCCTGTGTGCAACGCCTGCG
GCCTTTATTTTAAACTACACAATGTCAACAGGCCTTTGAC
AATGAAGAAGGATGGCATACAAACTCGAAACCGCAAGGTT
TCAAACAGAAACAAGAAGGGCAAAAAGAATGCAGCTTCAG
AAGTTTATCCTGACATGTCTCACATGGCACCTCCAGATGA
GCATGTAGGAGCGTATTCTCTGAACCCAGGACCCCTTCTG
TCCTACAGTCACCCGGCTCATCTACTGCCAACTTCCACCT
TACACTCCTCTACCACTTTGCCCTACACCCATCACCCAAA
CTCTGGCATGATGCCCACACTAGTGTGAAGGAAACATCCA
CGGGACCATAACGAAGCTTGTAAATTATGTTGTACACACT
TTTTGTTTCCCTCAATAAATGCATCCCGTCCTATTTTTAT
TGAAAGAGATGCATTAAAGCTGCTCCATATCTGCTGCAGT
CAAACAGCTTGTCAGTGATATTTGAACCTGTTGTGTAGTT
GAATAGAAAAACATGGCTGAAACTGTGAGCTATATCATTT
AAATGTAAATATTGATGATTGTATGGCTTATTGTATGTGC
TTTAATCAGACTATTACGACTTCTTTTGAGACGTTCAATA
AATGTCTTGTACTTAAA

gata1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gata1a-201 1657
ncRNA gata1a-002 (1)    Ensembl 730
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gata1a-201 Contained in:
[BAC] DKEYP-97E7 (1)

Genome Resources: Vega_Trans:OTTDART00000037310 (1),  Ensembl_Trans:ENSDART00000013714 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC124483 (1) 1618 bp
CITATIONS (2)