Transcript

nbr1-002

ID
ZDB-TSCRIPT-090929-17280
Name
nbr1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036834 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036834|OTTDARG00000027398|ZDB-GENE-030131-9112 nbr1|no_translation nbr1-002 LG_ BX001014.6 Danio rerio protein_coding KNOWN, 4359 bp
CAAAAGACAAGTCTCACAGTGTTGACAGCACCACGGGCAT
TTAGAGCGTCGTATCCCCTCATCAAACGCTTCCGTTGACT
CTGGCTCACAGACATGAACCTCCCCGTCACTGTCAAAGTG
AACTTTAGGGGCAACGTGAAGAAATTTCCAGTCTTGGACA
CGAACAAAGCACAGTGGGAGACTGTGGAGGCCTGGATTAA
AACTACTTTCGGCTTGAGCCATTTTCAAGTGAAATATTTT
GACGAGGACAACGAAGAGGTGTGCATAAACAGTCAAGATG
AATATACAGAAGCTCTAAAGAGTGCGTTTAAACAAGCCAA
CCAGCTCCACATGAATGTCTATAAGATGAAGGGTCAGGCA
GAGGGTGGTGCAGTTAAGGCAGAGCTGAAGGAACTAAAGA
TAGACCCCAGACCAGCTCCGCCATATCGAGCTAGGGTCAA
GATGGCAGACAAAGAGACCCAGGTGACCCCCGAGCGGGAA
TCGGCTGTGGCCAAAGAAAACAAAGGGATGAAAACTGAAG
AAGAAGCAGTCCCCACTTGGTTTAAATCCTACATGGACAG
GTTCAAAGACCAAGTGGTAAGGGAGGTGGTGGACAGGATG
TGCAGTGAGTTTTCTGGCCAGTGTTGCACACACAGAGCCT
CAGATCCTCCTGCAGAGGAACCAAGCACCTCTGGCACACA
GAAACCAGTCAGCTCCACCACACTGAGGGCCTCTAGCTCA
ACTCCAAATTGCAGTAGTTGCAAAGGACCAGCCACTGGGG
GAGGATATCAGTGCAGTGTTTGTCCATCTTGCATCTTATG
CGAGCCATGCAGTCATAAACACGATCCCAGCCACAACCTA
AAGAGAACAAGGACTCCTCTGTCTGTCCCTGAACGTGGAG
TTACCCCTGAACCCAGGTTTCTGAGGCGGGGTGACAGGAC
GGTGAGAAAGGCGGAGAGGCAGCGTCTAAAAGCAGAGCGG
AGGCAGCTGAAGGCTGAGGTGAAGGAGATCAAGAAGAAGC
TGAGGCTGGAGAAGAGAGGTCTGCTGTGGAGTGGAGCCTC
CAACGGGACCAGCACCTCAGGCCTTGCCCCCGCTCCCGCC
CCGTCTCTAGGTGCAGGACCAGCCCCAGCTCCGGCCCTGT
GCCCAGACCCTCAAACTTCCAGTCCAGAGTAAGGGCCACA
CTGAGAGGGGTCAGGGCTGGGTGACCTCCCTACCCAGCCC
AGAACAAACATTATCAAGATTTATCACATTGTCTGTTATA
GTTGAGTTATCGCTGGCAAATGGATGGAACTACCTCAAAA
TAGCACCCGCTGCCTTTATGTATTACGTCCTTTTTTGTAC
TTTTTTGATATGAACTTCAAGGAAAAGACAGACGCTGAAA
CAAAGCTGTTCTGATGATCCTCTGTGCACTCAAACCAGGG
GTCCCAAGGTCTCCGGCTCCACCTTGGTGCCCACAATGAC
TGCCTTGTTTCTGGATGAGAATCTACCAGATGGCACTTGT
CTGGAGCCAGGCACCAAGTTCATCAAGTACTGGAAGATGA
GGAACACTGGCAACATCAGCTGGACTTCCGACACTAAGTT
GAAGTTCATGTGGGGCAACCTGACCCTGGGATCACGAGAG
CATAAAGAGGTCGCAGTGCCCTTTCTGCAGCCGGGGCAGG
TTGGCGTGGTGAGTGTGGCGTTTGTGGCACCCCTGCTGGA
GGGCACCTACACGTCTCACTGGCGCCTGGCACATTGTGGT
GTGCAGTTTGGGCCCAGAGTGTGGTGTAGCATTGTGGTGG
TGCCAAGCACAGGGCAGAAACCCAGCATCCACTGCAGCAA
ATCACTGCGGACTGATCTGTGTCTAATGGGGAAAGACGGC
ATGTTCTGGTCAGGCACCAGAGACTGTGAAGTGTCGGCCA
GCTCCAGAAGAGAATACTGCATCCCCTCTGTTGACTTGCT
GACAGCACAGGATCTGCTGTCCTTTGAGTTACTGGATATA
AACATTGTGCAAGAATTGGAGAAAGTCCCAGCCAATGCTC
CATCTGATATGACCTCCTGTGTATCTCCAACTCTTCACCA
TGGAGCTTTGTTTGGGAAGCACGGAACAGGACAAAGCAAA
GTCGAAGTTGGACGTTCATGCAGGAAGAAAATTCAAGTCC
TGCAGCCTCAGAGACAAAACGAGCTTCTGGATGTTCCAGG
CAATGAGGAAGGAGACGAAGACATCAGTGGCACTCAGTTT
GTGTGTGAGACTGTGATTCGCTCTCTGACTCTTGAGGAGG
AACCAGAACGCAAACCTCAACGCAGAGCACGGCCCAGCCT
GAGGAGGCATGATGTTCCAGATCCTGTTCGCTTAAAGGAG
AGATCAGTGCCGGTGAAGAATGACAGACCAGTCATAAACA
GGCCTGAGGCTCCAGTTCCTGTGTCAAAGCCAATCATAAC
AGATGAACCTGTCTTTCCAGTTTTTACAGAGGCATTGATT
GGCTCAAATGAAAACCTCTACACCGACCCAGCTGCACAGG
AGGAGAATGAAGAGGAAGCGGAACAAAAGGGACGTGAAAA
TGAGCAAGAAAAAGAGGAAGAAGCAGGAGAGTGGGATGAG
GTGAGCAGCCAGGTGTCCTCTGCCTCATCTGAGGACTACA
TTGTCATCCTGCCTGACTGCTTCGATACTTCCAGGCCCCT
GGGAGAATCGATGTATAGCTCTGCAATGTCCCAGGCTGCA
GTACCTCTTGCCAATGGGCCAGAGGCACCGCAAAACCCAA
GCACGGCTGAAGGAGAGAATGAAGAGCCAAGCCCTGTCGC
AGTTCTTCAGAACAGCCTGAACCGGATGCTGTCCACCTCT
CAGATACTGGACACTCCTCCTCTGATTCCAGAGATGGTTC
CTGTGCCTGTCGCTCTGTCACCACCCCCGTCTCTCCGAAC
ACACAGATTAGTGAGATCTCATGATGTTGAGTCAGAACCA
GGGGATGAGAACACCTCATGCCAACCCGAGGATGACTCAA
GCGGTTGCAGATCAGCTCATTTAGAGGCCCCTGTTAGTGC
CTTTGAGACCTGTGGCCCCCAGGATCCCCGGGCACGTAAT
GGTGGTCTGACGGAGGGGCTGGTGAAGGGAGCTCTGTCTG
TAGCTGCTTCTGCTTATAAAGCACTGTTCACAGGCCAGAG
CACACCTGCACAGCGGCCTGAAGTGGACCCAGCCTGTGAA
GACGCCTCATTAATGGCTGTATTACAGGAGATGGGCTTCA
GCAACCAGCCGCTCAACCAGAGGCTGCTGAGAAAGCATCA
CTACAACTTACTTGATGTGGTCAACGAGCTGGTGCAGTTG
ACCGACAGCGAATGGCACATCTCAAGACATTAGGAAGCAC
CGCCGCGACCTCAACGACGTGTAAGAATTGTAAATGATTT
CATTGTGTTGCAGCTTTCTGTCAGAACAGGAGAAACACAG
CTGATGTTTATTTGTTAGAGAGTCTGGAGAAGAAAAAGAG
AGAACTATATCACTATAACTGACAGTAGCTGCAATGATGC
AATTACTTGATTGTAAACTTTTAGTTTCATGTTTGTAGGA
CATTATGAATGGGGAAAATACACAAGGTTTATCAAAGGGA
AATTTCACCATTTAAAAAAGGACATTTTCTTCACTTACTC
AGCTTGATTCAGACTCTTTTCAGATTCTTATTTCTGTTGG
GACACAAAAGAAGATACTTTGAAGAGTGTTGAAATTCAGT
AGTCGTTTGCTCCCATAGTATATATATTTTTTTCAATGGC
CAACATTCTTTAAAATACCTTCTTTTGTGTTCAACAAAAG
AAAGAAACTTGTAAAGGTTTGGAACCACTTGAGGGTGAGT
GAATAGTGAGTAAATGTTCATTTTTTGGTGAACTGTCCCT
CTTTAAGCAGTCTTAACGCTACCTTTATTCAGTGCGTGTG
CCCTACTAACCTGTTAGGTAGGCTTCAGGTAAATTTTGTA
CTGCTTGATTAGATATGATGATTAATTTGAAACAATACCA
GAGGGTTTCGGTTTGTTTGAGCACTTTTGCCTCTTGGAGG
AAAGCTATATAAAGAACAGCCTGTGTTGATTTTGTTATTT
GTCACGGTGACCTTTATATTTGTATATCTTATTTTAAATC
ACACTACTTCATGCGTCACACTAAGGTATTGGGCTGCCAA
ACTTATAGGAATGTGCAATGAGTTTTTCAGTCATGCTTAA
CACAACGATTGATTGATTGATTGATTGATTGATTGATTGA
TTGATTGATTGATTGATTGATTGATTGGTCAAAGATTTTG
CTATAGGCACCAATTTTGGTCATCTTTGTCATTTTCATGT
GCAATGTATTATTATGAACTGAAGGCTTATCAACATGGCT
TTTGTGTCCAACACAGTGAATAAAAACATTCCATTATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations