Transcript

nbr1a-201

ID
ZDB-TSCRIPT-090929-17279
Name
nbr1a-201
Previous Names
  • nbr1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036833 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036833|OTTDARG00000027398|ZDB-GENE-030131-9112 nbr1|OTTDARP00000029532 nbr1-001 LG_ BX001014.6 Danio rerio protein_coding KNOWN, 4136 bp
CTGAATCTAGCGATGTAAACAAGAACGCAAAAGACAAGTC
TCACAGTGTTGACAGCACCACGGGCATTTAGAGCGTCGTA
TCCCCTCATCAAACGCTTCCGTTGACTCTGGCTCACAGAC
ATGAACCTCCCCGTCACTGTCAAAGTGAACTTTAGGGGCA
ACGTGAAGAAATTTCCAGTCTTGGACACGAACAAAGCACA
GTGGGAGACTGTGGAGGCCTGGATTAAAACTACTTTCGGC
TTGAGCCATTTTCAAGTGAAATATTTTGACGAGGACAACG
AAGAGGTGTGCATAAACAGTCAAGATGAATATACAGAAGC
TCTAAAGAGTGCGTTTAAACAAGCCAACCAGCTCCACATG
AATGTCTATAAGATGAAGGGTCAGGCAGAGGGTGGTGCAG
TTAAGGCAGAGCTGAAGGAACTAAAGATAGACCCCAGACC
AGCTCCGCCATATCGAGCTAGGGTCAAGATGGCAGACAAA
GAGACCCAGGTGACCCCCGAGCGGGAATCGGCTGTGGCCA
AAGAAAACAAAGGGATGAAAACTGAAGAAGAAGCAGTCCC
CACTTGGTTTAAATCCTACATGGACAGGTTCAAAGACCAA
GTGGTAAGGGAGGTGGTGGACAGGATGTGCAGTGAGTTTT
CTGGCCAGTGTTGCACACACAGAGCCTCAGATCCTCCTGC
AGAGGAACCAAGCACCTCTGGCACACAGAAACCAGTCAGC
TCCACCACACTGAGGGCCTCTAGCTCAACTCCAAATTGCA
GTAGTTGCAAAGGACCAGCCACTGGGGGAGGATATCAGTG
CAGTGTTTGTCCATCTTGCATCTTATGCGAGCCATGCAGT
CATAAACACGATCCCAGCCACAACCTAAAGAGAACAAGGA
CTCCTCTGTCTGTCCCTGAACGTGGAGTTACCCCTGAACC
CAGGTTTCTGAGGCGGGGTGACAGGACGGTGAGAAAGGCG
GAGAGGCAGCGTCTAAAAGCAGAGCGGAGGCAGCTGAAGG
CTGAGGTGAAGGAGATCAAGAAGAAGCTGAGGCTGGAGAA
GAGAGGTCTGCTGTGGAGTGGAGCCTCCAACGGGACCAGC
ACCTCAGGCCTTGCCCCCGCTCCCGCCCCGTCTCTAGGTG
CAGGACCAGCCCCAGCTCCGGCCCTGTGCCCAGACCCTCA
AACTTCCAGTCCAGAGGGTCCCAAGGTCTCCGGCTCCACC
TTGGTGCCCACAATGACTGCCTTGTTTCTGGATGAGAATC
TACCAGATGGCACTTGTCTGGAGCCAGGCACCAAGTTCAT
CAAGTACTGGAAGATGAGGAACACTGGCAACATCAGCTGG
ACTTCCGACACTAAGTTGAAGTTCATGTGGGGCAACCTGA
CCCTGGGATCACGAGAGCATAAAGAGGTCGCAGTGCCCTT
TCTGCAGCCGGGGCAGGTTGGCGTGGTGAGTGTGGCGTTT
GTGGCACCCCTGCTGGAGGGCACCTACACGTCTCACTGGC
GCCTGGCACATTGTGGTGTGCAGTTTGGGCCCAGAGTGTG
GTGTAGCATTGTGGTGGTGCCAAGCACAGGGCAGAAACCC
AGCATCCACTGCAGCAAATCACTGCGGACTGATCTGTGTC
TAATGGGGAAAGACGGCATGTTCTGGTCAGGCACCAGAGA
CTGTGAAGTGTCGGCCAGCTCCAGAAGAGAATACTGCATC
CCCTCTGTTGACTTGCTGACAGCACAGGATCTGCTGTCCT
TTGAGTTACTGGATATAAACATTGTGCAAGAATTGGAGAA
AGTCCCAGCCAATGCTCCATCTGATATGACCTCCTGTGTA
TCTCCAACTCTTCACCATGGAGCTTTGTTTGGGAAGCACG
GAACAGGACAAAGCAAAGTCGAAGTTGGACGTTCATGCAG
GAAGAAAATTCAAGTCCTGCAGCCTCAGAGACAAAACGAG
CTTCTGGATGTTCCAGGCAATGAGGAAGGAGACGAAGACA
TCAGTGGCACTCAGTTTGTGTGTGAGACTGTGATTCGCTC
TCTGACTCTTGAGGAGGAACCAGAACGCAAACCTCAACGC
AGAGCACGGCCCAGCCTGAGGAGGCATGATGTTCCAGATC
CTGTTCGCTTAAAGGAGAGATCAGTGCCGGTGAAGAATGA
CAGACCAGTCATAAACAGGCCTGAGGCTCCAGTTCCTGTG
TCAAAGCCAATCATAACAGATGAACCTGTCTTTCCAGTTT
TTACAGAGGCATTGATTGGCTCAAATGAAAACCTCTACAC
CGACCCAGCTGCACAGGAGGAGAATGAAGAGGAAGCGGAA
CAAAAGGGACGTGAAAATGAGCAAGAAAAAGAGGAAGAAG
CAGGAGAGTGGGATGAGGTGAGCAGCCAGGTGTCCTCTGC
CTCATCTGAGGACTACATTGTCATCCTGCCTGACTGCTTC
GATACTTCCAGGCCCCTGGGAGAATCGATGTATAGCTCTG
CAATGTCCCAGGCTGCAGTACCTCTTGCCAATGGGCCAGA
GGCACCGCAAAACCCAAGCACGGCTGAAGGAGAGAATGAA
GAGCCAAGCCCTGTCGCAGTTCTTCAGAACAGCCTGAACC
GGATGCTGTCCACCTCTCAGATACTGGACACTCCTCCTCT
GATTCCAGAGATGGTTCCTGTGCCTGTCGCTCTGTCACCA
CCCCCGTCTCTCCGAACACACAGATTAGTGAGATCTCATG
ATGTTGAGTCAGAACCAGGGGATGAGAACACCTCATGCCA
ACCCGAGGATGACTCAAGCGGTTGCAGATCAGCTCATTTA
GAGGCCCCTGTTAGTGCCTTTGAGACCTGTGGCCCCCAGG
ATCCCCGGGCACGTAATGGTGGTCTGACGGAGGGGCTGGT
GAAGGGAGCTCTGTCTGTAGCTGCTTCTGCTTATAAAGCA
CTGTTCACAGGCCAGAGCACACCTGCACAGCGGCCTGAAG
TGGACCCAGCCTGTGAAGACGCCTCATTAATGGCTGTATT
ACAGGAGATGGGCTTCAGCAACCAGCCGCTCAACCAGAGG
CTGCTGAGAAAGCATCACTACAACTTACTTGATGTGGTCA
ACGAGCTGGTGCAGTTGACCGACAGCGAATGGCACATCTC
AAGACATTAGGAAGCACCGCCGCGACCTCAACGACGTGTA
AGAATTGTAAATGATTTCATTGTGTTGCAGCTTTCTGTCA
GAACAGGAGAAACACAGCTGATGTTTATTTGTTAGAGAGT
CTGGAGAAGAAAAAGAGAGAACTATATCACTATAACTGAC
AGTAGCTGCAATGATGCAATTACTTGATTGTAAACTTTTA
GTTTCATGTTTGTAGGACATTATGAATGGGGAAAATACAC
AAGGTTTATCAAAGGGAAATTTCACCATTTAAAAAAGGAC
ATTTTCTTCACTTACTCAGCTTGATTCAGACTCTTTTCAG
ATTCTTATTTCTGTTGGGACACAAAAGAAGATACTTTGAA
GAGTGTTGAAATTCAGTAGTCGTTTGCTCCCATAGTATAT
ATATTTTTTTCAATGGCCAACATTCTTTAAAATACCTTCT
TTTGTGTTCAACAAAAGAAAGAAACTTGTAAAGGTTTGGA
ACCACTTGAGGGTGAGTGAATAGTGAGTAAATGTTCATTT
TTTGGTGAACTGTCCCTCTTTAAGCAGTCTTAACGCTACC
TTTATTCAGTGCGTGTGCCCTACTAACCTGTTAGGTAGGC
TTCAGGTAAATTTTGTACTGCTTGATTAGATATGATGATT
AATTTGAAACAATACCAGAGGGTTTCGGTTTGTTTGAGCA
CTTTTGCCTCTTGGAGGAAAGCTATATAAAGAACAGCCTG
TGTTGATTTTGTTATTTGTCACGGTGACCTTTATATTTGT
ATATCTTATTTTAAATCACACTACTTCATGCGTCACACTA
AGGTATTGGGCTGCCAAACTTATAGGAATGTGCAATGAGT
TTTTCAGTCATGCTTAACACAACGATTGATTGATTGATTG
ATTGATTGATTGATTGATTGATTGATTGATTGATTGATTG
ATTGGTCAAAGATTTTGCTATAGGCACCAATTTTGGTCAT
CTTTGTCATTTTCATGTGCAATGTATTATTATGAACTGAA
GGCTTATCAACATGGCTTTTGTGTCCAACACAGTGAATAA
AAACATTCCATTATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations