ZFIN ID: ZDB-TSCRIPT-090929-17053
Transcript Name: ilf3a-007
Previous Name: zgc:113842-007

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036590|OTTDARG00000027266|ZDB-GENE-030131-3151 ilf3a|no_translation CH211-276A17.3-007 LG_none CR394534.6,CR954228.5 Danio rerio protein_coding KNOWN, 755 bp
AATTTTGAAGATTGAGTTACACCTTTGTATGGTGTAGACG
TTTTATTTGGTATGATTGGTTCCACTTCATCTTACAGGGT
GGCCCCATCCTCACCAAACATGGCAAGAATCCCGTCATGG
AGCTCAATGAGAAGCGCAGAAGTCTGAAATATGAGCTTGT
CTCTGTCAAGGGACGCTTCAACGACAAGACCTTCACTATT
GAGGTGGATGTTGATGGACAGAAATTTCAGGGCTCTGGAT
CAAATAAGAAATTAGCCAAAGCCAACGCAGCACTTGCGGC
TTTAGAACAGCTGTTTCCAAATTGTCCTCCAGAACCGGTC
AAGAAAAAGAAATTCAATCCTATGGGATATGGTATGGGTG
GGGTGTCTTTCAATCGAGGCAGGGGTAGAGGCAGAGGTCG
AGGCAGAGGATTTAACACCACCAAGTTTACAGACCCCAGC
ACCTCTGTGAATCCCCAGGCAGACCCATCCGCTGCCTCCA
CCGCCAGCGCAGCCACCTACCAGGCTGTTCCTCCACCTGT
GACTGGTTATTACAACCAATACACCCAATCCTACTCACAG
TTCAAAAAACCCCAGGACCAGGCCCAGAATGAGAATCAAA
ACCAGAGCAAAACAGCAAATCAACAGGCTCCTCTTGTTGG
ACCAGACTATGGCTATGGGTATCAAGGGGCTGGCATGAAC
ATGGCAGCACCACCTAATTACAATTATGCTGCATACAGTG
GACCCCCTGGAACAGCATCATTCGGACCACCTGGA

ilf3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ilf3a-002 (1) 940
ilf3a-003 (1) 774
ilf3a-004 (1) 736
ilf3a-005 (1) 945
ilf3a-007 755
ilf3a-008 (1) 832
mRNA ilf3a-202 (1) 3200
ilf3a-204 (1) 624
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ilf3a-007 Contained in:
OTHER ilf3a-007 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036590 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT671016 (1) 755bp
    CITATIONS (1)