header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17048
Transcript Name: ilf3a-002
Previous Name: zgc:113842-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036585 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036585|OTTDARG00000027266|ZDB-GENE-030131-3151 ilf3a|no_translation CH211-276A17.3-002 LG_none CR394534.6,CR954228.5 Danio rerio protein_coding KNOWN, 940 bp
TGGAGCATTTTACGCTTTCATTCAGTAAACTGAGCCAGCA
GTGTGTGCAACAAATCTTTTTAGATTTGAAGACAAATACA
TGGGCACTGAATATTAAAGTCTACGAGTTTCTTATAGCAT
TAGAAGCTGTGCAGGTTATTGTGTGAAGAATATGGCTCAA
ATGAGACATTTTCCGAGACGAAGGGACGGACCTCTTCCGC
CTCGACCACCACCCGCCTGGGACGAGCACCTGGCCTACGA
GGAGCTGCTGCACTGGGATAATCTCATGCAGGAGGGGTAC
CACCTCCACCCGCACGACTACGAGCGGTATGAAGAGTTGC
GTTATTGGTATGATTGCTTGTGTTATGAAGAAGACCTCAG
GCAGTACAATGACTACATCGTGGAGTACAGGAAGTGGGAG
GAGGAGAATTTGCACCCAGAGGAACCGATGCCACCAATGA
GGCCACCGCCTCAGCGAACGTTTGTGAATGAGGATCGTTA
TTTACGGGCCAAGCACACAACAGTATATCCGTCATCAGAG
CAGCTAGATGCTGTGCAGAACATGGTGTCTCATATAGAGT
TTGCAATGAAGGCTGTCTCTGATTGGTTTAATGAAAAAGA
GGCCGGTGACACCGATACTAAAAGCAAATCCTCGCAAAGT
AAACTGCGTGGCGTTTTGAGAGTAGGCCTGGTGGCTAAAG
GACTCCTGCTCAAAGATGACTTGGATTTAGAGTTGGTGCT
GCTCACCAGAGATGCACCTACCAGCTCCCTCCTCAGGCTG
GTCTCTGGAAAACTCTCAGAACTCATAAAGGTTGTTCCTT
ACACTTTGCTTATTTGATTCTGTGGTTATTCTATGAATTT
TGCTTGCTTTTTTGTCATCTTTTAGAACCCATTTATGAAA
CATACGCATTAAGATTGGCTGGCAAAATTGATCAGCATCT
TTACATTAAGAAAAAGAAAA

ilf3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ilf3a-002 940
ilf3a-003 (1) 774
ilf3a-004 (1) 736
ilf3a-005 (1) 945
ilf3a-007 (1) 755
mRNA ilf3a-202 (1) 3200
ilf3a-204 (1) 624
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ilf3a-002 Contained in:

OTHER ilf3a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036585 (1)
  • Ensembl_Trans:ENSDART00000123420 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153903 (1) 946 bp
    CITATIONS (2)