header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17052
Transcript Name: ilf3a-204
Previous Names: ilf3a-006, zgc:113842-006

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036589 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036589|OTTDARG00000027266|ZDB-GENE-030131-3151 ilf3a|OTTDARP00000029351 CH211-276A17.3-006 LG_none CR394534.6,CR954228.5 Danio rerio protein_coding KNOWN, 624 bp
TTTGCATTACGACTGTCAGCGTTTGGGCAGCTTTACAAAG
TTTTGGGAATGGACAGGCTCACTTCCAAAGCTGCTAGAAT
GATTGAACACAGAGTGCCTGATCCTCCAATAAAGAGACCA
AGGGAATCTTTTGATGGTGGGGATTTTGATACTAGGCTGA
AGTTTCCAAGAAAAGAAAGGAAAGAGCCACCAAATGCCCT
GATGAAGCTAAATCAACTGCGTCCTGGGACTGTTTACAAA
TTGGCATCACAGACTGGGCCTGAACATGAGCCTCAGTTCT
CAATGACTGTAGAGGTGGATGGGGTAACATATGAGGCAAC
AGGCCCTTCCAAACGCAGCGCCAAGCTCCATGTTGCCCAG
AAAGTACTGGTGGCGTTAGGTGTACCTCTGCCATCAGAGA
CCAAGCCGGCTGAGGAAAAGAAGAGCCAGTCTGTTTCCAC
TCCTGCAGCCACTGCTTCAAGTGAAAACACTCCCACAGGC
TCTGATGACGGCGCTGAGGGTGGCCCCATCCTCACCAAAC
ATGGCAAGAATCCCGTCATGGAGCTCAATGAGAAGCGCAG
AAGTCTGAAATATGAGCTTGTCTCTGTCAAGGGACGCTTC
AACGACAAGACCTTCACTATTGAG

ilf3a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ilf3a-002 (1) 940
ilf3a-003 (1) 774
ilf3a-004 (1) 736
ilf3a-005 (1) 945
ilf3a-007 (1) 755
ilf3a-008 (1) 832
mRNA ilf3a-202 (1) 3200
ilf3a-204 624
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ilf3a-204 Contained in:
OTHER ilf3a-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036589 (1)
  • Ensembl_Trans:ENSDART00000131513 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI889191 (1) 673bp
    CITATIONS (2)