ZFIN ID: ZDB-TSCRIPT-090929-16985
Transcript Name: os9-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036508 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036508|OTTDARG00000027222|ZDB-GENE-060929-32 os9|no_translation os9-003 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 834 bp
GACAACGCTTGTTTGCGATATGAGAGAACTATGGCTTCCT
CCTTGATTAAGTGATGGAAGATGTAATGTTGGTCTCTAAC
AAATACAAGCAGCTGTATGAGTGTCGTTTACCAGCTCAGG
CAGTGCGTTTCCATCAGGACCCGGTGTCAGAGCCTGATGT
GCAGGGTTACAGCGGCCCCGGGGTCCCTGAGCTCCTCAAG
CCCATGCAGACGGCAGCATGTCTGATTAAGACCAAAGACT
GGTGGACCTATGAGTTCTGCTACGGCCAGCACATCAGACA
ATACCACTTAGAAGATTCGGAGATCAAGGGAGATGTACTG
TTTTTGGGATATTATGATACAGAGTTTGACTGGACGAATG
AAACTGCAAAGGCATCTAAGCAGCATAAGCTGAAGAGGTA
TCACAGTCAGTCATATGTCAATGGCTCAAAATGTGACTTA
AACGGCAGTCCCAGAGAGACGGAAGTCAGATTTGTGTGTG
AGGAAGGCTCTACTGACTTCATTTCACGGGTGGATGAACC
CCAGTCTTGCCGCTACGTCTTGACAGTCCACACCTCTCGC
ACGTGCCAGCATCCCCTTCTGCGCCCACCGTCCACTGCCA
AACCACAAGGCATTGTGTGCCAACCTGCTCTCAGTGCCCA
GCAGTACATGGACTACGTCAAGGCTCAAGTCTCTGACACC
AAACGTAAAGTGGAGCAGATCTCAGAGGAGCTCAGAAACC
TGGATGAAATTCTGTCCAAGGATGACAAGAACAAAGGTGT
GCTGGATGACAGAACAGATGAGGAACCTGCAGTTAGCTCT
GATGAGCCTCCAGTTTCCAAGGCCCAAAAAAAAG

os9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA os9-202 (1)    Ensembl 2419
ncRNA os9-002 (1)    Ensembl 1323
os9-003 834
os9-004 (1)    Ensembl 697
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
os9-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036508 (1),  Ensembl_Trans:ENSDART00000138171 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN017054 (1) 943 nt
CITATIONS (2)