ZFIN ID: ZDB-TSCRIPT-090929-16984
Transcript Name: os9-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036507 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036507|OTTDARG00000027222|ZDB-GENE-060929-32 os9|no_translation os9-002 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 1323 bp
AACTATGGCTTCCTCCTTGATTAAGTGGTTAAGAGGATTA
TATGTGTTTTTCTTAACATGTCTCCTGTCTGTCTTTGCCT
TTTTGAATCTAGAAGAATTAAACGAAATGAAATATGGCAT
ACAGATTCTCCCCGATCCTGTTATCATGGGACAGATGGAA
GATGTAATGTTGGTCTCTAACAAATACAAGCAGCTGTATG
AGTGTCGTTTACCAGCTCAGGCAGTGCGTTTCCATCAGGA
CCCGGTGTCAGAGCCTGATGTGCAGGGTTACAGCGGCCCC
GGGGTCCCTGAGCTCCTCAAGCCCATGCAGACGGCAGCAT
GTCTGATTAAGACCAAAGACTGGTGGACCTATGAGTTCTG
CTACGGCCAGCACATCAGACAATACCACTTAGAAGATTCG
GAGATCAAGGGAGATGTACTGTTTTTGGGATATTATGATA
CAGAGTTTGACTGGACGAATGAAACTGCAAAGGCATCTAA
GCAGCATAAGCTGAAGAGGTATCACAGTCAGTCATATGTC
AATGGCTCAAAATGTGACTTAAACGGCAGTCCCAGAGAGA
CGGAAGTCAGATTTGTGTGTGAGGAAGGCTCTACTGACTT
CATTTCACGGGTGGATGAACCCCAGTCTTGCCGCTACGTC
TTGACAGTCCACACCTCTCGCACGTGCCAGCATCCCCTTC
TGCGCCCACCGTCCACTGCCAAACCACAAGGCATTGTGTG
CCAACCTGCTCTCAGTGCCCAGCAGTACATGGACTACGTC
AAGGCTCAAGTCTCTGACACCAAACGTAAAGTGGAGCAGA
TCTCAGAGGAGCTCAGAAACCTGGATGAAATTCTGTCCAA
GGATGACAAGAACAAAGGTGTGCTGGATGACAGAACAGAT
GAGGAACCTGCAGTTAGCTCTGATGAGCCTCCAGTTTCCA
AGGCCCAAAAAAAAGAGGGTGAAGTTGCTGAGAAGTCGAC
GAGTGAAGAGCCAGAGGACAAAGACTTCTGGGAAGGAGTT
ACCAAACCAGCACACACAAAGCCAAGCACACCTGACACAG
AGTATTTGGAGAGGAAAAGTTTAACTTTAAAATCATCACA
GACCCCGCAGACCTCATGAAGTTTGTACAACACCTCAGAG
AGAGCAACGAAAAGAACAGGAAAGCTGAGCTGGAAAAAGA
AAACCAGCAAGCATCTCAGAAGAGGAAGGAGAAGGAGGAA
AAAATAGAGGAGAAAACAGCAGAGGTGGAGGTGGAAGTTG
AGGATGTAGATGAAGATGAAACATTGCTTCAGGAGTTTGA
GGATGAGATGCAAGATCTATCCGTTCCCTCGTCCAAGATA
GAA

os9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA os9-002 1323
os9-003 (1) 834
os9-004 (1) 697
mRNA os9-202 (1) 2419
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
os9-002 Contained in:
OTHER os9-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036507 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC115098 (1) 1339bp
    CITATIONS (1)